ID: 1109725304

View in Genome Browser
Species Human (GRCh38)
Location 13:66332709-66332731
Sequence TGCCCAGAATGTCCTTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109725304_1109725309 -1 Left 1109725304 13:66332709-66332731 CCACAGGAAGGACATTCTGGGCA 0: 1
1: 0
2: 2
3: 25
4: 251
Right 1109725309 13:66332731-66332753 AACAGGAACCAGAGGAGAAGGGG 0: 1
1: 0
2: 5
3: 53
4: 571
1109725304_1109725306 -9 Left 1109725304 13:66332709-66332731 CCACAGGAAGGACATTCTGGGCA 0: 1
1: 0
2: 2
3: 25
4: 251
Right 1109725306 13:66332723-66332745 TTCTGGGCAACAGGAACCAGAGG 0: 1
1: 0
2: 1
3: 23
4: 247
1109725304_1109725307 -3 Left 1109725304 13:66332709-66332731 CCACAGGAAGGACATTCTGGGCA 0: 1
1: 0
2: 2
3: 25
4: 251
Right 1109725307 13:66332729-66332751 GCAACAGGAACCAGAGGAGAAGG 0: 1
1: 0
2: 3
3: 38
4: 462
1109725304_1109725308 -2 Left 1109725304 13:66332709-66332731 CCACAGGAAGGACATTCTGGGCA 0: 1
1: 0
2: 2
3: 25
4: 251
Right 1109725308 13:66332730-66332752 CAACAGGAACCAGAGGAGAAGGG 0: 1
1: 1
2: 2
3: 45
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109725304 Original CRISPR TGCCCAGAATGTCCTTCCTG TGG (reversed) Intronic
900386837 1:2414499-2414521 TGCCCCGAGGGTCCTTCCTGAGG + Intergenic
901320911 1:8339339-8339361 AGACCAGAAAGTACTTCCTGGGG - Intronic
901664135 1:10816966-10816988 TGCCCTGATTGCCCTGCCTGGGG + Intergenic
902187152 1:14733989-14734011 TGCCCAGGATGCCCTTCATCTGG + Intronic
902781024 1:18705189-18705211 CGGCCAGAATGTCTTCCCTGGGG + Intronic
902857602 1:19220360-19220382 TGCCTAGAAAGTTCTTCCTCAGG + Intronic
903976087 1:27151122-27151144 TGCCACCAATGTCCTTCCTTAGG - Intronic
904032777 1:27543526-27543548 TGCCCAGAATGCCCTTCCCCCGG + Intronic
904489575 1:30850134-30850156 TGCCCAGCATCCACTTCCTGCGG - Intergenic
904989489 1:34580165-34580187 TGCCTAGAAAGCCCTTCCTCTGG - Intergenic
905274977 1:36811667-36811689 TGCCCCGAAATTCCCTCCTGGGG - Intronic
905882787 1:41475343-41475365 TGCCCAGCATGCCCTCCATGAGG - Intergenic
909717002 1:78721074-78721096 TGCTCAAAATGTCCTTCATCTGG - Intergenic
911036549 1:93556196-93556218 AACCCAGAATCTCCATCCTGAGG + Intergenic
911098067 1:94071751-94071773 TGCCCACATTTTCCTTCCTCAGG + Intronic
911101976 1:94102463-94102485 TGCTCAGGAAGGCCTTCCTGAGG - Intronic
912539488 1:110402686-110402708 TGCCCTGGATGACCTTCCAGTGG + Intronic
913011821 1:114690928-114690950 TTTCCATACTGTCCTTCCTGAGG - Intronic
913377792 1:118173547-118173569 TGCCCATAATCTCTTTCCTCAGG - Intronic
913967221 1:143386250-143386272 TGCAAAGATTGTGCTTCCTGTGG + Intergenic
914061600 1:144211857-144211879 TGCAAAGATTGTGCTTCCTGTGG + Intergenic
914117550 1:144754512-144754534 TGCAAAGATTGTGCTTCCTGTGG - Intergenic
915321941 1:155061145-155061167 TGCTCAGAATGGCCTTCCGTAGG + Intronic
915648626 1:157291690-157291712 TACCCAGCATGTCATCCCTGAGG - Intergenic
915900703 1:159844721-159844743 TGCCCAGAATGGCTCTCCTCTGG - Intronic
916484940 1:165250278-165250300 TGCCCAGAATGTATTTGCTGTGG + Intronic
917459626 1:175218874-175218896 TGCACAGGAATTCCTTCCTGGGG + Intergenic
918276168 1:182955506-182955528 TGCCCAGAATCTCCTTCAGATGG - Intergenic
918387577 1:184025563-184025585 TGCCCAGGAGGTCCTTCCTTTGG - Intronic
919790341 1:201286399-201286421 GGTCCTGACTGTCCTTCCTGGGG - Intronic
921222197 1:212981167-212981189 TGGCCAGAGTCTCCTGCCTGGGG + Intronic
921831566 1:219733183-219733205 TACCAAGAATGCCTTTCCTGGGG - Intronic
921836672 1:219785447-219785469 AGCCGGGAAGGTCCTTCCTGGGG - Intronic
922551318 1:226496777-226496799 TGCTCAGAATGTCAGCCCTGGGG - Intergenic
924797872 1:247305558-247305580 TGGCCAGAGCATCCTTCCTGAGG - Intronic
924934351 1:248755635-248755657 GGTCCTGAATGCCCTTCCTGCGG + Intronic
1062862434 10:821402-821424 GGTCCAGAATGTGGTTCCTGAGG - Intronic
1064186579 10:13167262-13167284 TGCCCCTAATGCCCTCCCTGTGG - Intronic
1066011013 10:31193344-31193366 TCCCTAGAATGTCCTTGCTCTGG - Intergenic
1067335235 10:45356309-45356331 AGCCAAGAAGGGCCTTCCTGAGG + Intergenic
1068135885 10:52951179-52951201 TTCCCAGAGTTTCCTACCTGGGG - Intergenic
1069825876 10:71254672-71254694 TCCCCAGAGAGGCCTTCCTGTGG + Intronic
1069869023 10:71521867-71521889 GGCCCAGCCTTTCCTTCCTGGGG + Intronic
1069876914 10:71568685-71568707 GGCCGAGAATCTCCTTCCTTGGG - Intronic
1069982408 10:72261421-72261443 TTCCCAGAGTGGCCTTCCTATGG + Intergenic
1073203888 10:101758382-101758404 TTCCCAGAATGACCATCCTCCGG - Intergenic
1073559123 10:104481892-104481914 TGCCCTGAGTGTCCCACCTGGGG + Intergenic
1073636750 10:105207033-105207055 GTCTCAGAATGTCATTCCTGGGG + Intronic
1076869488 10:133186368-133186390 TGTCCAGAAAGGCCTTCCTGGGG - Exonic
1077206874 11:1349045-1349067 CGCCCTGCATGGCCTTCCTGAGG - Intergenic
1077252047 11:1565033-1565055 TCCCCAGAAGGACATTCCTGGGG + Intronic
1077432094 11:2520731-2520753 CGCCCAGTGTTTCCTTCCTGGGG + Intronic
1077725598 11:4672015-4672037 TGCCCATAATCTTCTTCCTGGGG - Intergenic
1078628369 11:12979304-12979326 TGCCCAGGCTCACCTTCCTGAGG + Intergenic
1079299264 11:19262941-19262963 TGCCTAGAATGCCCCTCCTCTGG - Intergenic
1081027031 11:38028076-38028098 TGCTTAGAATGTCCTTCCCTAGG + Intergenic
1081189686 11:40088276-40088298 TGCCCAAACTGTCCTACCTTTGG - Intergenic
1081868210 11:46371336-46371358 TGGCCACAATCTCCTTGCTGTGG - Exonic
1083570796 11:63761486-63761508 TGCCCAGCATGTCAATCCTTCGG + Exonic
1083710375 11:64544769-64544791 TTCCTAGAATGTCCTTCCTCAGG + Intergenic
1086334320 11:85784198-85784220 TTCACTGAATGTCTTTCCTGGGG - Intronic
1088556419 11:111065745-111065767 TCCACAGAATTTCCTGCCTGTGG - Intergenic
1088942738 11:114477052-114477074 TGACCAAAATGTCCTTCCACAGG + Intergenic
1089682292 11:120125449-120125471 TGCCCAGGATGTCCCTGCTCTGG + Intronic
1090905214 11:131068743-131068765 TGCTCACCATGTCATTCCTGGGG - Intergenic
1091221133 11:133930757-133930779 TCCCCAGAAAGACCTCCCTGAGG + Intronic
1095410539 12:41916065-41916087 TGCCAGGAATCTCCTTGCTGTGG - Intergenic
1096631075 12:52927169-52927191 TGTCCTGAATCTCCTCCCTGGGG - Intronic
1096678075 12:53236382-53236404 TGCACAGAATCTCCATCCAGGGG + Intergenic
1098527193 12:71499644-71499666 TGCACAGAGTCTCCTTCATGGGG + Intronic
1102205208 12:111085610-111085632 TGCCCAGAATGCTCTTCCCCTGG + Intronic
1102380922 12:112466277-112466299 TACCTAGAATGTTCTCCCTGAGG - Intronic
1102497888 12:113332065-113332087 TGCCCAGAATGCTCTTCCCCGGG + Intronic
1103459089 12:121089630-121089652 TTCCCAGACTGACCTTTCTGGGG - Intergenic
1103459102 12:121089703-121089725 TTCCCAGACTGACCTTCCTGGGG - Intergenic
1103956111 12:124577810-124577832 TGCCCCAAATGTCCTTTCTGTGG - Intergenic
1104643575 12:130482182-130482204 TGCAGAGACTGTCCGTCCTGAGG - Intronic
1104727814 12:131088542-131088564 TGCCCGGACTGTCCTTGCTCAGG - Intronic
1104743842 12:131198130-131198152 AGCAGAGAATGCCCTTCCTGTGG + Intergenic
1105209954 13:18251921-18251943 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1105945296 13:25184493-25184515 TGGCCAGGATGTTCTTACTGAGG + Intergenic
1106780076 13:33050519-33050541 TCCCCAGAATGAGCTCCCTGTGG - Intronic
1107787186 13:43969017-43969039 TGGCCACAATCTCCTTGCTGTGG - Intergenic
1108362113 13:49677324-49677346 TGATCTGAATGACCTTCCTGGGG - Intronic
1109725304 13:66332709-66332731 TGCCCAGAATGTCCTTCCTGTGG - Intronic
1113560748 13:111278778-111278800 TCCCCAGAATCTCATTCCAGTGG + Intronic
1113948029 13:114055805-114055827 TGCCCAGGCTGTCCTGGCTGCGG + Intronic
1114497611 14:23144176-23144198 GGCCCAGGATCTCATTCCTGGGG - Intronic
1116019267 14:39441373-39441395 TGCCCAGGCTGTCCATGCTGAGG - Intergenic
1117590762 14:57265807-57265829 TACTCAGAATGTCTATCCTGAGG + Intronic
1118597405 14:67446573-67446595 TCCCCAGAATGTCCTTTCCCAGG + Intergenic
1119774351 14:77239325-77239347 TGCCCAGCATGTCGGCCCTGAGG - Intronic
1122272455 14:100574282-100574304 GGCCAAGAATGTCCTTCCCCTGG + Intronic
1123153163 14:106201917-106201939 TTCCCAGAGTGTCCTACCTGGGG - Intergenic
1123916446 15:25033569-25033591 TGGCCAGAATGTCCACCGTGGGG - Intergenic
1124719306 15:32098014-32098036 TGCCCTGAATGTCCTTCTGCCGG + Intronic
1125507623 15:40276125-40276147 TGCCCAGTGTGCCCTGCCTGTGG - Exonic
1127045381 15:55019957-55019979 TGTCCAGAATGCCCTTCTTTTGG - Intergenic
1127322670 15:57863035-57863057 TTCCCAGCATGACCTTCCTTGGG - Intergenic
1128695937 15:69762894-69762916 TGGTCAGGATGTCCTTGCTGGGG + Intergenic
1128992423 15:72272283-72272305 GGCCCAGAGCGTCTTTCCTGGGG - Intronic
1129121155 15:73397567-73397589 TGCACAGGCTGTCCTTCCTGAGG + Intergenic
1129297836 15:74609550-74609572 TGCCCAGATTCCCTTTCCTGTGG + Intronic
1130782019 15:87050173-87050195 TGCCCAGAATGCTTTTCCTCTGG - Intergenic
1131711408 15:95059980-95060002 AGGCCAGAATGACTTTCCTGGGG + Intergenic
1132654721 16:1036990-1037012 TGCCCAGGGTATCCTACCTGGGG + Intergenic
1133018259 16:2954900-2954922 TGCCCAAATGGCCCTTCCTGGGG + Intergenic
1134109126 16:11503728-11503750 TTCCCAGAATGTGCCTTCTGTGG + Intronic
1137005574 16:35272128-35272150 TCCCCAGGATTTCCTACCTGGGG - Intergenic
1137323126 16:47406885-47406907 TGCCTAGAATATTATTCCTGCGG - Intronic
1138559359 16:57791397-57791419 GGCCCCGTCTGTCCTTCCTGTGG - Intronic
1139479758 16:67223825-67223847 TGCCCAGAATGCCCTTCGGGAGG - Intronic
1140250999 16:73294372-73294394 TGAACAGCATGTCCATCCTGGGG - Intergenic
1141150197 16:81559122-81559144 TGCCCAGCATGCCCGGCCTGTGG - Intronic
1142470717 17:161850-161872 TCCCCTGAAGGTGCTTCCTGGGG - Intronic
1142696935 17:1639003-1639025 TACCCAGAAGCTTCTTCCTGGGG + Intronic
1142782034 17:2188765-2188787 AGCTCAGACTGCCCTTCCTGAGG - Intronic
1144018527 17:11220160-11220182 TGTCCAAAATGTCTGTCCTGGGG + Intergenic
1145262621 17:21363957-21363979 TGCCCACATTGTCTTCCCTGTGG - Intergenic
1145935621 17:28713048-28713070 TGCCCAGACCCTCCTTCCCGTGG + Intergenic
1148481482 17:47962350-47962372 CTCCGAGAATGTCCTTCATGGGG - Intergenic
1148835103 17:50461798-50461820 TACGCAGAGTGTCCTTCCTTAGG + Intronic
1151166101 17:72205247-72205269 TTCCAAGAATGTCCCTGCTGTGG + Intergenic
1151535419 17:74736606-74736628 TGCCCAGAATGTCCCACCAGGGG - Intronic
1151981429 17:77512234-77512256 GGCCCAGAATGCCCTTCATCAGG - Intergenic
1153545194 18:6197684-6197706 TGCCAACACTGGCCTTCCTGGGG + Intronic
1155210912 18:23601101-23601123 TGCCCAGAATGCCCATCCTGTGG - Exonic
1158806181 18:60976552-60976574 AGCTCAAAATTTCCTTCCTGCGG + Intergenic
1159602466 18:70441761-70441783 TGCCCAGTAGCTTCTTCCTGGGG - Intergenic
1161370761 19:3909632-3909654 TGCCCCCACTGTGCTTCCTGAGG - Intronic
1163581374 19:18141189-18141211 TGACTAGAAAGTCCTGCCTGGGG - Intronic
1164797461 19:31045513-31045535 TTATCTGAATGTCCTTCCTGAGG - Intergenic
1166348874 19:42184566-42184588 GGCCCAGCATGCCCTTCCAGAGG + Intronic
1167356533 19:49007540-49007562 TGCCCATAATGTCCTTCATAAGG - Intronic
1168209996 19:54883436-54883458 TGCCCACCATGCCCTGCCTGAGG - Intronic
1168214118 19:54912712-54912734 TGCCCAGAATCTCCTTCGGATGG + Exonic
1168677174 19:58286950-58286972 TTCTCAGCATGTCCTTTCTGTGG + Intronic
1202701007 1_KI270712v1_random:163745-163767 TGCAAAGATTGTGCTTCCTGTGG + Intergenic
925424922 2:3741455-3741477 TGCCCAGAATGTCACAACTGTGG + Intronic
926223495 2:10951581-10951603 TGCCCAGATTGCCCTTGCTCAGG + Intergenic
926918657 2:17917595-17917617 TGCCCAGAGTGTTGATCCTGAGG + Intronic
929559127 2:42944916-42944938 TTCCCAGAATGCCCTGCTTGTGG - Intergenic
929671234 2:43877573-43877595 TTTCCAAAGTGTCCTTCCTGCGG + Exonic
930031917 2:47063652-47063674 AGGCCAGAGTGTCCTCCCTGGGG - Intronic
931670416 2:64642278-64642300 GGCCCAGATTCTCCTTGCTGGGG + Intronic
932143243 2:69297625-69297647 TGCCCAGGAGGTGCTGCCTGTGG - Intergenic
932691378 2:73916663-73916685 TGCCAACAATGTCCTCTCTGGGG + Exonic
934171937 2:89547221-89547243 TGCAAAGATTGTGCTTCCTGTGG + Intergenic
934282245 2:91621539-91621561 TGCAAAGATTGTGCTTCCTGTGG + Intergenic
934777631 2:96949392-96949414 TAACCAGATTCTCCTTCCTGAGG + Intronic
934938212 2:98480536-98480558 TGCCCAGAATGTCAGTGCAGGGG - Intronic
934939174 2:98487921-98487943 TGCGGAGAATTACCTTCCTGTGG + Intronic
937034469 2:118769453-118769475 TGTCAAGAAGGTTCTTCCTGAGG - Intergenic
938671719 2:133593034-133593056 TTCCTGGATTGTCCTTCCTGAGG + Intergenic
938738077 2:134204611-134204633 AGACCAAAATCTCCTTCCTGGGG - Intronic
938887651 2:135669239-135669261 AGCCCACAATGTCCTCTCTGTGG - Intronic
939321185 2:140624901-140624923 TGCCTAGAATGTTCTTCCATAGG - Intronic
939637922 2:144605644-144605666 TGTCCAGTTTCTCCTTCCTGTGG + Intergenic
940496480 2:154435380-154435402 GGCCCAGCCTGTCCTTGCTGTGG - Intronic
943311253 2:186327938-186327960 TGACAGGAATGTCTTTCCTGGGG + Intergenic
943401378 2:187415644-187415666 AGCCCAGAATGTCCTTGAGGGGG - Intronic
943452947 2:188068323-188068345 TGCCATGAATGTGTTTCCTGAGG - Intergenic
946046539 2:216826161-216826183 TTCCCAGAAGGTTCCTCCTGCGG + Intergenic
947794232 2:232884176-232884198 TGCCCACAATGTCCCTCCCCAGG + Intronic
948486303 2:238283472-238283494 TGCCTAGAATGTTCTTCCTCTGG - Intronic
948887801 2:240892747-240892769 TGGTCAGAATGTGCCTCCTGTGG - Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1170983527 20:21237718-21237740 TGCACAGCATGCCCTTCCTGTGG + Intronic
1171291102 20:23983611-23983633 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1172168950 20:32917349-32917371 TGCTCAGGATGTCCTCCGTGTGG - Intronic
1172633965 20:36396930-36396952 TTCCCAGAAACTCCTCCCTGGGG - Intronic
1172664123 20:36587379-36587401 TGCCCAGACTGCCCTCCATGAGG + Intronic
1172706262 20:36884356-36884378 TGCCTAGAATGTCCCTCCACTGG + Intronic
1174421230 20:50400345-50400367 TACCAAGAATGCCCTTCCTCTGG - Intergenic
1175601009 20:60273161-60273183 TGCCTAGAATTTCTCTCCTGGGG + Intergenic
1176894228 21:14357144-14357166 TGCCTAGAATGTTCTTCCATTGG + Intergenic
1177955732 21:27596272-27596294 TGCTTAGAATGTACTTCCTTTGG - Intergenic
1178124260 21:29499999-29500021 TGCCCAGGCTGCCCTGCCTGCGG - Intronic
1178699667 21:34822248-34822270 TGCCCGGAAGGTCCTGCCTGTGG - Intronic
1180766305 22:18347482-18347504 GTCCCTGAATGTCCTTCCTCAGG - Intergenic
1180780008 22:18514896-18514918 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1180812724 22:18772217-18772239 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1181031167 22:20149452-20149474 CGCCCCGGATGTCCTTCTTGAGG + Exonic
1181198882 22:21206465-21206487 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1181648531 22:24246580-24246602 GTCCCTGAATGTCCTTCCTCAGG + Intergenic
1181702839 22:24630422-24630444 GTCCCTGAATGTCCTTCCTCAGG - Intergenic
1181828681 22:25540997-25541019 AGCCCAGCATGTTCTTCCAGTGG + Intergenic
1181881231 22:25981986-25982008 TGCCATGATTGTGCTTCCTGAGG - Intronic
1182698072 22:32209712-32209734 GGCACAGAATGTGCATCCTGTGG + Intergenic
1184339698 22:43879432-43879454 GGCCCAGGAAGGCCTTCCTGAGG - Intergenic
1184425557 22:44407158-44407180 TGTCCAGGCTGTCCCTCCTGAGG - Intergenic
1203227923 22_KI270731v1_random:88372-88394 GTCCCTGAATGTCCTTCCTCAGG - Intergenic
949474495 3:4430799-4430821 TGCCCTGACAGTGCTTCCTGCGG + Intronic
950720048 3:14876108-14876130 TCCCCACCATGTCCTACCTGTGG - Intronic
951018816 3:17759833-17759855 TGCTGAGAATGTCCTTCCCCAGG - Intronic
952043859 3:29293685-29293707 TTCCCAGATTGTCCTTCCTAGGG + Intronic
953762067 3:45696293-45696315 GGCCCAGAATTTCCTTTCTAAGG + Intronic
954125354 3:48524994-48525016 AGCCCATCCTGTCCTTCCTGTGG - Intronic
954534600 3:51350018-51350040 TGCTGTGAATGTCCTTCCTAGGG - Intronic
955891135 3:63651379-63651401 TGCCCAGACTGCCCCTTCTGAGG + Intergenic
956176806 3:66480728-66480750 TGCCAAGAATGTGTTTTCTGTGG - Intronic
956224236 3:66937905-66937927 TGCCAGGAATGTCCTTTCTCAGG + Intergenic
959063708 3:101637222-101637244 TTCCCAGAGTGTCCTACCTGGGG + Intergenic
960740048 3:120823438-120823460 TGCTGAGAATTTCCTTCCTTGGG + Intergenic
962083543 3:132166152-132166174 TGGCCAGAGAGGCCTTCCTGAGG - Intronic
962335185 3:134523471-134523493 TGTCCAGAATGGCATTGCTGGGG + Intronic
962881922 3:139586511-139586533 GGCCCAGGCTCTCCTTCCTGAGG + Intronic
963140125 3:141940085-141940107 GAACCAGAAAGTCCTTCCTGTGG + Intergenic
963709205 3:148727010-148727032 TGCCCAAAATTTGATTCCTGTGG - Intronic
966494874 3:180568528-180568550 TGCCTAGAATGTTCTTCCCAAGG + Intergenic
967044878 3:185727305-185727327 TGCCCAGACTAACCTTCCGGAGG - Intronic
969027814 4:4188666-4188688 TGCAAAGATTGTGCTTCCTGTGG - Intergenic
969284036 4:6191321-6191343 TCCCCTGCATGTCCCTCCTGAGG + Intronic
969525793 4:7703451-7703473 TCCCCAGAATGTCCTCCCCTCGG + Intronic
969683411 4:8655897-8655919 TGCCCAGAATGCCCCTTCTGGGG + Intergenic
976615743 4:87074363-87074385 TGCCCACAATGGGCTTCATGGGG + Intronic
976839147 4:89410880-89410902 TGCCCACAATGTGCTCCCTTCGG - Intergenic
977482959 4:97601756-97601778 TCTCCAGAATGTTCTTCCTTAGG + Intronic
980730914 4:136823680-136823702 TGATCAGAACGTCCTGCCTGCGG - Intergenic
981227242 4:142311843-142311865 AACCCAGAATGTGCTACCTGGGG + Intronic
982966934 4:161921080-161921102 TGCCAAGGATGTGCTTTCTGTGG - Intronic
986413252 5:7502890-7502912 TCCCTAGAAAGTTCTTCCTGAGG + Intronic
987136845 5:14907669-14907691 TGCCCAGGAAGTCCTTCCATGGG - Intergenic
987362790 5:17122013-17122035 TACCCAGACTGTCTTTGCTGGGG + Intronic
987814486 5:22882683-22882705 ATCCCAGAATCTACTTCCTGGGG + Intergenic
991562831 5:67972599-67972621 TGCCAAGATTGTGTTTCCTGAGG - Intergenic
993346501 5:86789867-86789889 TTCACAGAATTTCCTTCCAGGGG + Intergenic
995485660 5:112637533-112637555 TGCCAAGGATGTTCTTCATGTGG - Intergenic
996474294 5:123897985-123898007 ACCACAGTATGTCCTTCCTGGGG - Intergenic
997234812 5:132266621-132266643 TGCACTGAATGTCCTCACTGGGG + Intronic
998971097 5:147593334-147593356 TGCCCAGAATGGCCAGCCTTTGG + Intronic
999504529 5:152181128-152181150 TGCCATGAATGTGTTTCCTGAGG - Intergenic
1000143723 5:158432525-158432547 TGCCCAGCATGTTCTACATGAGG + Intergenic
1002523829 5:179805322-179805344 GACCCAGAATGTCCTTCCCCAGG + Intronic
1005427438 6:25717312-25717334 AGTCCAGAGTTTCCTTCCTGGGG - Intergenic
1006473736 6:34242445-34242467 TCCCCAGAATGCCTTTCCTAGGG + Intronic
1007114876 6:39336313-39336335 TGACCACAACATCCTTCCTGTGG - Exonic
1007228358 6:40330427-40330449 TACCCAGAGCTTCCTTCCTGGGG - Intergenic
1015391235 6:132684376-132684398 AACCCAGTATGTCTTTCCTGAGG - Exonic
1015794042 6:136993063-136993085 AGCCCAGAAGTTCCTCCCTGAGG - Intergenic
1019640277 7:2099788-2099810 TGGCCAGAATGGCCTACCAGGGG - Intronic
1019729239 7:2621346-2621368 TGCCAGGAATGTCCTTCCCGTGG + Intergenic
1022449822 7:30504506-30504528 TGCCCAGAAGGCGCTTCCTCGGG - Intronic
1023239723 7:38130656-38130678 GGCCCAGTCTGTCATTCCTGTGG - Intergenic
1023574401 7:41610435-41610457 TGCCTAGAATGTCTTTTCTTTGG + Intergenic
1024597301 7:50949199-50949221 ACCCAAAAATGTCCTTCCTGAGG + Intergenic
1024611890 7:51073214-51073236 TACCCAGAATTTACTTCCTTTGG - Intronic
1026145820 7:67745600-67745622 TGCTCAGAAGGTCCTTCATCAGG + Intergenic
1032118915 7:129142321-129142343 TGACCACAATGTCCCTCATGTGG - Intergenic
1033286973 7:140049644-140049666 TGGCCCCCATGTCCTTCCTGAGG - Intronic
1035311318 7:157970769-157970791 TGCCCAGCATGCCCTCTCTGGGG + Intronic
1036594584 8:10200473-10200495 TTCCCACCATGGCCTTCCTGGGG + Intronic
1037871694 8:22503698-22503720 TGCCCAGAATTTCTTACCTTAGG + Intronic
1040652210 8:49462006-49462028 TGCCAAAAATTTCCCTCCTGTGG - Intergenic
1041528091 8:58831320-58831342 TGCCCAGTATGTGCCTACTGTGG + Intronic
1044904950 8:96990760-96990782 TTACCAGAATGCCCATCCTGTGG - Intronic
1045111949 8:98944798-98944820 TGCCCAGGTTGACCTTTCTGCGG + Exonic
1046298607 8:112256455-112256477 TACCTAGAATGCCCTTCCTTAGG - Intronic
1046663110 8:116970255-116970277 TGCCCCTAAAGTCCTTCCAGTGG - Intronic
1049254060 8:141604678-141604700 GGCCCCGGCTGTCCTTCCTGTGG + Intergenic
1049860304 8:144893752-144893774 GGCCCTGAATGTACTTCCTGTGG - Intronic
1053284129 9:36839528-36839550 TGCCCAGAATCCACTTGCTGGGG + Exonic
1055763576 9:79636629-79636651 AGCCAAGAAAGTCCTTCCTCAGG - Intronic
1055767607 9:79681580-79681602 TGTCTAGAATGTCCTTAATGTGG - Intronic
1057457649 9:95228807-95228829 TGCCCAGCAACTCCTTCCTGGGG - Intronic
1058426374 9:104878521-104878543 TTCCCAGAATATCCCTTCTGTGG + Intronic
1060834331 9:126743625-126743647 CTCCCAGAATCTCCTTCCAGGGG - Intergenic
1060958289 9:127660371-127660393 TGCTGAGAATGACCTTCCTGAGG + Intronic
1061383780 9:130276333-130276355 TGCCCGCAATGACATTCCTGAGG + Intergenic
1062386697 9:136314937-136314959 GGCCCAGAATGACCCTGCTGGGG - Intergenic
1185516278 X:701512-701534 TTCCCAAAATGTCCTGTCTGTGG + Intergenic
1186334715 X:8574018-8574040 TGCACAGAATCTCCTTACTTAGG + Intronic
1189202572 X:39210157-39210179 TGCCAGGAATGGCTTTCCTGAGG + Intergenic
1189328026 X:40124951-40124973 TGCCTAGAATGTCTTTCCCAGGG - Intronic
1189375036 X:40459927-40459949 TGCCCAGAATCTCATCCCTGAGG + Intergenic
1190357385 X:49618403-49618425 TGCCCAGAAGGACCTTCCTGGGG + Intergenic
1190732107 X:53233266-53233288 AGCCCAAGATATCCTTCCTGAGG - Exonic
1200846485 Y:7836166-7836188 TTGCCAGAGTGTCCTACCTGGGG + Intergenic
1201627650 Y:16032544-16032566 TGCCCCTCATGTCCTTCCTAAGG + Intergenic