ID: 1109725933

View in Genome Browser
Species Human (GRCh38)
Location 13:66341836-66341858
Sequence CTTGTGTCTCACTGCGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109725929_1109725933 15 Left 1109725929 13:66341798-66341820 CCATGGTCAGGGCAGAACAGAGG 0: 1
1: 0
2: 4
3: 30
4: 307
Right 1109725933 13:66341836-66341858 CTTGTGTCTCACTGCGCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 107
1109725927_1109725933 26 Left 1109725927 13:66341787-66341809 CCAGAACGAGGCCATGGTCAGGG 0: 1
1: 0
2: 2
3: 57
4: 208
Right 1109725933 13:66341836-66341858 CTTGTGTCTCACTGCGCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109725933 Original CRISPR CTTGTGTCTCACTGCGCTCA AGG Intronic
900542541 1:3211161-3211183 CTTGTCTGTCTCTGCACTCATGG + Intronic
901735421 1:11309301-11309323 CTTGTGTCCAACTGCCCACATGG - Intergenic
910452084 1:87357614-87357636 CATGTGACTAACTTCGCTCATGG - Intergenic
911161026 1:94683493-94683515 CCTGCGTCTCACTGCCCTCCAGG - Intergenic
914263947 1:146021702-146021724 CTGCTGTCTCACTGAGGTCAGGG + Exonic
1064525768 10:16254997-16255019 ATTGTGTGTCACTGCGCTTTGGG - Intergenic
1067738000 10:48873675-48873697 CTTGTGCCTTCCTGAGCTCAGGG - Exonic
1069191336 10:65494910-65494932 TTTGGGTCTCACAGAGCTCAGGG + Intergenic
1073741809 10:106415967-106415989 CTTTTGTCTCACAGCTCTTAAGG - Intergenic
1074219675 10:111424153-111424175 CTTGGCTCTGACTGTGCTCAAGG - Intergenic
1076659437 10:132045504-132045526 CTTGTGTCTTCCAGCCCTCAAGG + Intergenic
1077192556 11:1261536-1261558 CTTCTGTGTCCCTGCGCCCATGG + Exonic
1077213303 11:1383333-1383355 CGTGTGTCTCCCCGCGCTGAGGG - Intergenic
1078119960 11:8497338-8497360 CTTCTCTCTCACTGCTTTCAAGG - Intronic
1078616525 11:12871023-12871045 CTTTTGACCCACTGCTCTCAAGG + Intronic
1081235310 11:40640328-40640350 ATTTTGTCTTACTGCGCTGACGG + Intronic
1082272554 11:50187427-50187449 CTTGTGTCTAACTGCCCTTATGG - Intergenic
1090894854 11:130963133-130963155 CTTTTGTCTCACAGCTCTTAAGG + Intergenic
1093166023 12:15805081-15805103 CTTGTGTCTGGCAGCCCTCAGGG - Intronic
1098897473 12:76080685-76080707 CTTGTATCCCACTGTGCTCTAGG - Intronic
1101311105 12:103580164-103580186 CATGTGTCTCCCTGCCCTCATGG - Intergenic
1101554804 12:105799048-105799070 TGTGTGTCTCACTTCACTCATGG + Intergenic
1102216885 12:111167971-111167993 GTTGTGAGCCACTGCGCTCAGGG + Intronic
1103358703 12:120341290-120341312 CTTGTGTCTCTGTGCATTCAGGG - Intergenic
1108382565 13:49868259-49868281 ATCGTGTCTCCCTGCCCTCATGG + Intergenic
1109725933 13:66341836-66341858 CTTGTGTCTCACTGCGCTCAAGG + Intronic
1109852275 13:68081332-68081354 CATGTGTTTCACTGCTCTAAGGG - Intergenic
1114219464 14:20683760-20683782 CTTGTGTCTCACTGAGCCCGGGG - Intergenic
1115470976 14:33768294-33768316 CTTATGTAACACTGAGCTCAGGG + Intronic
1115835330 14:37396384-37396406 CTTTTGTCTCACAGCTCTTAAGG + Intronic
1123756105 15:23398930-23398952 GTTGTGTATCACTGTGCCCATGG + Intergenic
1124076837 15:26454145-26454167 CTGGTCTTTCACTGCCCTCAAGG - Intergenic
1124831238 15:33151452-33151474 CTTGTCACTCAGTGGGCTCACGG + Intronic
1125276151 15:37994399-37994421 CTGGAGTCTCACTGTTCTCATGG + Intergenic
1131952242 15:97693367-97693389 CTTGTGTATCACTGAGCCAAAGG + Intergenic
1132895318 16:2226360-2226382 CCTGTGTCTCACTCGGCTCCAGG - Intronic
1134717781 16:16365500-16365522 CTTCTCGCTCACTGCGCTCGAGG + Intergenic
1134847427 16:17451722-17451744 CTTCTATCTCACTAAGCTCAAGG - Intronic
1139155320 16:64434620-64434642 CTTCTGTCTCACTGAGCTGAGGG - Intergenic
1141747345 16:85934452-85934474 CCTGTTTCTCACTGCCCTCGTGG - Intergenic
1142348328 16:89568390-89568412 CTTGTGGCCCACTGCTCTCACGG - Intergenic
1144419942 17:15087340-15087362 CTTGTGTCTCACAACCGTCAAGG + Intergenic
1161290514 19:3491368-3491390 CTTGTGTCTTGCTGGGCGCATGG - Exonic
1166262738 19:41652622-41652644 CTTGTGTTTCAGCGCGCTGAGGG - Intronic
926149139 2:10415096-10415118 CTTGAGTCTCAGTGCTCTGAGGG + Intronic
926739851 2:16102248-16102270 CTCCTGTCTCCCTGGGCTCACGG + Intergenic
926805382 2:16705891-16705913 CTTCTGTCTCACTATACTCAAGG + Intergenic
927860655 2:26558170-26558192 CCTGGGTCTCCCTGAGCTCAGGG + Intronic
931729579 2:65141088-65141110 CTTGTGTCACCCTGAGCCCAGGG - Intergenic
933588544 2:84206463-84206485 CTTGTTTCTAACAGGGCTCAAGG + Intergenic
934138353 2:89019707-89019729 CTTGTGTCTCATTGCTCAGAGGG + Intergenic
934224821 2:90122815-90122837 CTTGTGTCTCATTGCTCAAAGGG - Intergenic
934230898 2:90180918-90180940 CTTGTGTCTCATTGCTCAGAGGG - Intergenic
934962426 2:98688402-98688424 ATTGTGTCTGCCTGCACTCAAGG - Intronic
937000082 2:118457756-118457778 CTTCTGTCTCACTGAAATCAGGG - Intergenic
939769719 2:146300120-146300142 CTTCTGTCTCACAGCTCTTAAGG - Intergenic
940030847 2:149259709-149259731 ATTGTGTCTCACTCCACTTAAGG - Intergenic
944160545 2:196654991-196655013 CTACTGTCTTACTGCTCTCATGG - Intronic
948884312 2:240875264-240875286 CTGGCCTCTCACTGCACTCAGGG + Intronic
1169800464 20:9507629-9507651 CCCGTGTCTGGCTGCGCTCAAGG - Intergenic
1169871713 20:10254877-10254899 CCTGTGTCTCATTGGCCTCAGGG + Intronic
1171248461 20:23632015-23632037 CTTCTGGCTCACTGGCCTCATGG + Intronic
1175284729 20:57830427-57830449 CTTCTGACTAACTGAGCTCAAGG + Intergenic
1176689851 21:9892675-9892697 ATTATGTATCACTGCTCTCAAGG - Intergenic
1181827533 22:25530302-25530324 CCTGTGTCTCACTGAGCTTTGGG - Intergenic
1182718051 22:32376002-32376024 CTTGGGTCTCACTGGGCTGTGGG - Intronic
1183935610 22:41260395-41260417 CTTGTGTCTCCCTGCACCCCTGG - Intronic
954130894 3:48560389-48560411 CCTGTGTCTCCCTGGGCCCAGGG + Intronic
954391842 3:50271697-50271719 CTTGTCTCTCTCTGGCCTCAAGG - Intronic
955473763 3:59314079-59314101 CTTGTGTCTCAGTTCTATCATGG + Intergenic
955687802 3:61563005-61563027 CTGCCGTCTCACTGCGCCCAAGG - Intronic
956126643 3:66017260-66017282 CTTGTGTCTCAACACGCGCAGGG + Intronic
961052052 3:123755273-123755295 CTGGTGGCTCACTGGGCTCTGGG + Intronic
978606689 4:110488115-110488137 CTTGTGTCTAACTGCCCTTATGG - Intronic
981396806 4:144259851-144259873 CTTTTCTCTCACTGCTTTCAGGG - Intergenic
981441295 4:144785921-144785943 CTTTTGACTCACTGCTCTGATGG - Intergenic
986067131 5:4245570-4245592 TTTCTGGCCCACTGCGCTCATGG + Intergenic
987211430 5:15687594-15687616 CTGGTGTAGCACTGCCCTCAAGG + Intronic
990942877 5:61221017-61221039 CTGGCTTCTCACTGCCCTCATGG - Intergenic
997211185 5:132077910-132077932 CTGGTCTCTCCCTGGGCTCAGGG - Intergenic
1001041227 5:168337010-168337032 CCAGTTTCTCACTGCGGTCATGG - Intronic
1003307002 6:4938346-4938368 CTTGTCCCTCACTCCCCTCAAGG + Intronic
1004156307 6:13171254-13171276 GTTCTGTCTCACTGCTCTCAGGG + Intronic
1009794049 6:68443161-68443183 CTTGTGTCTCATTTCTCTTAAGG + Intergenic
1010613343 6:77983707-77983729 TTTGTATATCACTGCTCTCATGG + Intergenic
1013076233 6:106774231-106774253 TTTGGGGCCCACTGCGCTCATGG - Intergenic
1016371323 6:143376999-143377021 CTTGTCTCTGACTGAGGTCATGG + Intergenic
1017355648 6:153504046-153504068 CATGTGTGTCACTGGGCCCATGG + Intergenic
1019617376 7:1971209-1971231 CTTGCCTCTCACTGCAATCATGG + Intronic
1022649203 7:32259394-32259416 CAAATGTCTCACTGTGCTCAGGG + Intronic
1025604009 7:63025809-63025831 TCTGTGTCTCTCTGCGCCCAGGG + Intergenic
1025624585 7:63208808-63208830 CTTGTGTCTAACTGCCCTTATGG - Intergenic
1028241970 7:88432576-88432598 CTTGTAGCTCACTGTTCTCAGGG - Intergenic
1029806655 7:103004519-103004541 TTTGTCTCTAACTGCTCTCAGGG + Intronic
1032859546 7:135864178-135864200 CCAGTGTCACACTGCACTCAGGG - Intergenic
1039083136 8:33754080-33754102 CTTTTGTCTCACAGCTCTTAAGG + Intergenic
1039799670 8:40943240-40943262 CTTGGGTCTCACTGGCCCCAGGG - Intergenic
1040443752 8:47472339-47472361 CTTGTGTCTGACTGACCTGAAGG + Intronic
1041718062 8:60950153-60950175 CTTGTGTCACAGTGCCCTTAAGG + Intergenic
1042480000 8:69292146-69292168 GTTGTGGCTCACTGCCCACACGG + Intergenic
1042712271 8:71731444-71731466 CTTGTGTCACTCTGAACTCAGGG - Intergenic
1046723721 8:117652170-117652192 CTTGTGTCTCACAGCGATCTAGG - Intergenic
1047488025 8:125350441-125350463 CCTGTCTCCCACTGTGCTCAAGG - Intronic
1047850613 8:128853029-128853051 CTTGTGTCTCATTTCTCTCATGG - Intergenic
1048977635 8:139681877-139681899 CTGGTGTCTCCCTGAGCTCCAGG - Intronic
1053667999 9:40330131-40330153 CTTCTGTCTCAGTGGGATCAGGG - Intergenic
1053917807 9:42956417-42956439 CTTCTGTCTCAGTGGGATCAGGG - Intergenic
1054379143 9:64470169-64470191 CTTCTGTCTCAGTGGGATCAGGG - Intergenic
1054516612 9:66046154-66046176 CTTCTGTCTCAGTGGGATCAGGG + Intergenic
1054902601 9:70385675-70385697 CCTATTTCTCACTGAGCTCATGG - Exonic
1056900487 9:90594873-90594895 CTTGTGGCTCATGGCACTCATGG + Intergenic
1058153321 9:101486109-101486131 CTAGTGTCGCACTGCGCTCGCGG - Intronic
1058310413 9:103494196-103494218 CTTGAGTTTCACCGCACTCATGG - Intergenic
1058941330 9:109815477-109815499 CTGGTGACTCACTGTGCTGAGGG + Intronic
1060660081 9:125400081-125400103 CTTTTGTCTCCTTGTGCTCAGGG + Intergenic
1061003490 9:127915740-127915762 CGTGTGTCTCTCTGGGCTCCAGG + Intronic
1187970054 X:24649891-24649913 CTTCTGTCTAACTGCCCTGAGGG + Intronic
1194492404 X:94568177-94568199 CTTTTGTCTCACTGAGCTGTGGG + Intergenic
1198618424 X:138481994-138482016 CTTTTGTCTCATTGGTCTCAGGG + Intergenic