ID: 1109727113

View in Genome Browser
Species Human (GRCh38)
Location 13:66356274-66356296
Sequence ACTTCCATGAAGGTGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109727113_1109727116 -8 Left 1109727113 13:66356274-66356296 CCCTGCAGCACCTTCATGGAAGT 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1109727116 13:66356289-66356311 ATGGAAGTCTTGTATTTTAAAGG 0: 1
1: 0
2: 1
3: 26
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109727113 Original CRISPR ACTTCCATGAAGGTGCTGCA GGG (reversed) Intronic
901091818 1:6646743-6646765 ACTTCATTCAAGGTGCTGAAGGG + Intronic
903484060 1:23676574-23676596 ACTTCCATGGTGATGTTGCATGG - Intergenic
904017825 1:27436640-27436662 TCTTCCTTGTAGTTGCTGCATGG - Intronic
905681827 1:39878387-39878409 ACTGCCCTGTAGGTGCTGTAGGG + Intronic
907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG + Intronic
909548188 1:76869340-76869362 CCTTCCGGGAAGCTGCTGCATGG + Intronic
913609929 1:120501109-120501131 AATTCCAAGAAGGGGCTGAAAGG - Intergenic
913984867 1:143555734-143555756 AATTCCAAGAAGGGGCTGAAAGG + Intergenic
914203886 1:145510029-145510051 AATTCCAAGAAGGGGCTGAAAGG + Intergenic
914483009 1:148083183-148083205 AATTCCAAGAAGGGGCTGAAAGG + Intergenic
914581260 1:149021132-149021154 AATTCCAAGAAGGGGCTGAAAGG + Exonic
916289279 1:163146768-163146790 ACTAACATGAAGGTGGTCCAAGG + Intronic
918583883 1:186163721-186163743 ACTTTCATGAAAGTCTTGCAAGG + Intronic
919966110 1:202526826-202526848 ACTTCCTTGTAGATACTGCATGG + Intronic
920044424 1:203124342-203124364 ACTTCCAGGAAGTCACTGCAGGG + Intronic
920147288 1:203872846-203872868 ACCTACATGAAGCTGCTGGAGGG - Intergenic
920459819 1:206130906-206130928 AGTTCCCCAAAGGTGCTGCAGGG + Intergenic
1063391765 10:5654273-5654295 ACTCCCAAGAAGGAGCTCCAGGG + Intronic
1065689329 10:28317052-28317074 AGTGCCAAGAAGGTGATGCAAGG + Intronic
1069426269 10:68291204-68291226 TGTCCCATGAAGGTTCTGCAGGG - Intronic
1070282176 10:75057990-75058012 TCTTCCCTCCAGGTGCTGCAGGG - Intronic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1073827357 10:107339431-107339453 ACTTCTTTGAAGGTGCAGGATGG + Intergenic
1074346606 10:112692395-112692417 GCTTCCATGAAGGTGCAGGGAGG - Intronic
1077219091 11:1407485-1407507 ATTTCCTTGAAGGTCATGCAGGG - Intronic
1080765005 11:35287876-35287898 ACTGCCATGGAAGTGCTTCATGG + Intronic
1085677963 11:78542929-78542951 ACTTTCTTGCAGTTGCTGCAAGG + Intronic
1087953479 11:104254714-104254736 ACTTCTGTGGAGGTGCTGCGTGG - Intergenic
1088811831 11:113397487-113397509 ATTTGCATGAAGGTACTCCAAGG + Intronic
1091275686 11:134347932-134347954 GCTACCAAAAAGGTGCTGCATGG + Intronic
1092677174 12:10933331-10933353 TCTTCCATGAAGGTGCTTTTGGG - Intronic
1093837539 12:23853503-23853525 ATTTTCATGTAGATGCTGCATGG + Intronic
1096244310 12:49975708-49975730 ACCTCCAGGCAGGTCCTGCAAGG - Exonic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1100048289 12:90411373-90411395 ACTTCCAAGACGGGGCAGCAGGG - Intergenic
1101346503 12:103890841-103890863 ACCTCCTTGTAGGTGCAGCAGGG + Intergenic
1102594335 12:113981099-113981121 ACTTCTATGAAGGTGGGGCCAGG + Intergenic
1103019875 12:117525397-117525419 ACTACAGTGAAGGTGCTGAAAGG + Intronic
1103738666 12:123077232-123077254 ATTTCCAAGAAGGTGGTGTAGGG - Intronic
1104989710 12:132618778-132618800 ACCTCCAGGAAGGCGCTGCAGGG - Intronic
1105516133 13:21092405-21092427 CCTTTCATGAAGGGGCAGCAAGG + Intergenic
1107719125 13:43229625-43229647 ACTTCCCTCAAGCTGCTGTATGG + Intronic
1108067683 13:46595288-46595310 CCTTTCCTGATGGTGCTGCATGG + Intronic
1109727113 13:66356274-66356296 ACTTCCATGAAGGTGCTGCAGGG - Intronic
1110768852 13:79312383-79312405 ACATTCATTAAGGTGCTGGAAGG + Intronic
1112096426 13:96137099-96137121 ACATCCAGGAAGTAGCTGCAAGG - Intronic
1113072582 13:106435760-106435782 ACTTCCACGAATGTGTTTCATGG + Intergenic
1113658189 13:112083482-112083504 AATTCTATGAAGCTGCTGCTGGG - Intergenic
1115126250 14:29998002-29998024 ATTCCCACAAAGGTGCTGCATGG + Intronic
1116255577 14:42549918-42549940 ACTTCCATGAAACTGCTCCCTGG + Intergenic
1119498630 14:75103335-75103357 AACTCCAGGAAGGTGATGCATGG + Intronic
1119848254 14:77846855-77846877 ATATCCATGGAGCTGCTGCATGG + Intronic
1120005721 14:79355479-79355501 ACTTGCTTGGAGTTGCTGCAAGG - Intronic
1122392578 14:101400220-101400242 ATTCCCATGCAGGTGCTGTAGGG - Intergenic
1122771705 14:104100614-104100636 ACTCCCTAGAAGGTGCTCCAGGG - Intronic
1126106582 15:45150791-45150813 ATTTGTTTGAAGGTGCTGCATGG - Intronic
1127208266 15:56743410-56743432 ACATCCATGAAGCTGGTGAATGG - Intronic
1127646812 15:60966908-60966930 ACTGCCATGATGTTTCTGCAGGG + Intronic
1127754438 15:62077329-62077351 CCTTCCCTAAAGGTGCTGCTAGG - Intergenic
1137966697 16:52941802-52941824 GCTTCCATGATGGCGCTGGAAGG + Intergenic
1139871393 16:70111406-70111428 ACAGCCATGCCGGTGCTGCAGGG + Intergenic
1142469996 17:157962-157984 AGTTCCCTGAAGGTGCTACCTGG + Intronic
1142911469 17:3097120-3097142 ACTTCCAAGAAGGTTCTTCCAGG + Intergenic
1142924370 17:3221088-3221110 ACTTCCAAGAAGGTTCTTCGAGG - Intergenic
1143563192 17:7707150-7707172 ATGTCCAGGAAGGGGCTGCAGGG + Intronic
1143662337 17:8333527-8333549 GCTTCCCTGATGGTGCTGCAAGG + Intergenic
1145237759 17:21221118-21221140 ACCTCCATGAGGGTGGGGCAGGG - Intergenic
1147352086 17:39857030-39857052 AGTTCCACAAAGGTGCTTCACGG - Intronic
1147920287 17:43912152-43912174 ACTTCAGTGGAGGTGCTGGAGGG - Intergenic
1147931000 17:43981166-43981188 ACTTCCAAGAATGTTCTGCTCGG - Intronic
1149641597 17:58206366-58206388 GATTCCATGAAGGCCCTGCAGGG + Exonic
1151351342 17:73533798-73533820 ACTTCCTTGAAGGAGCTGGAGGG - Intronic
1152307749 17:79531135-79531157 CCTTCCCAGAAGGTGCTACACGG + Intergenic
1156240312 18:35247337-35247359 ACTTCCATGAGGGTGGTGGTGGG + Exonic
1157433712 18:47651461-47651483 ACTTTCATGAAGGTCCCACAGGG - Intergenic
1157436625 18:47675783-47675805 AATTCCATGAAGGTGTTGAGAGG - Intergenic
1158728355 18:59995589-59995611 AATCCCATGAAAGTCCTGCAGGG - Intergenic
1160374031 18:78397423-78397445 ACATCAATGCAGGTCCTGCACGG + Intergenic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1163095940 19:15057114-15057136 ACTTCCAGCCTGGTGCTGCAAGG - Exonic
1165178421 19:33947193-33947215 ACTCCCATGGAGGTGCCCCAGGG + Intergenic
1166108488 19:40609422-40609444 ACATCCATGAAGGTGTTTTATGG + Intronic
1167772998 19:51532448-51532470 ATTTACATGAAGATGTTGCATGG - Intergenic
925704117 2:6667933-6667955 TATTCCATGAGGTTGCTGCATGG + Intergenic
925847480 2:8046825-8046847 ACTTTCATGAAGGTGGAGCTGGG - Intergenic
926243839 2:11107539-11107561 AGGTCCATGAAGGTGCTGCTGGG + Intergenic
928135002 2:28681475-28681497 CCTTCCAGGAAAGTGGTGCAGGG - Intergenic
936970260 2:118169971-118169993 AATTCCAAGAAGGTCCTCCATGG - Intergenic
937584508 2:123530194-123530216 ACTTCCCTGAAACTGCCGCATGG - Intergenic
940903206 2:159145765-159145787 GGTTCCATGAATGTGCTGCTGGG + Intronic
942378952 2:175367349-175367371 ACTACCATGAAGCAGCTTCATGG - Intergenic
943561431 2:189467878-189467900 ACTTTCATGGATGTGCTGAATGG + Intronic
944772205 2:202925808-202925830 ACTTACAAGAAGCTGCTGAAAGG + Intronic
945882152 2:215336658-215336680 ACTTCCAAGAAGGTGAAGCAGGG - Intronic
947358994 2:229327803-229327825 ACTTCCAGGACAATGCTGCATGG - Intergenic
1169728131 20:8758124-8758146 CCTTCCATGAAGGTGTGGAAAGG + Intronic
1169797824 20:9483970-9483992 ACTTCCAAGAAGGTAATGCTAGG - Intergenic
1170216328 20:13895714-13895736 ACTTCCATGACTATGCTGAATGG - Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1173519151 20:43686388-43686410 ATTTCCATGGAAGTGCTGGAGGG + Intronic
1174136943 20:48386281-48386303 ACGTCCATGCAGGAGCTGCTGGG - Intergenic
1179363313 21:40733118-40733140 ACATGCATGCAGGTGCTGGAGGG + Intronic
1181430426 22:22878107-22878129 GCTTCCAGGATGGTGCTGCTGGG - Intronic
1184956457 22:47890075-47890097 ACTTCCATGAAGATCCAGCCTGG + Intergenic
950873911 3:16253046-16253068 TCTTCCATGGAGGTGGTGGAGGG - Intergenic
950961158 3:17109350-17109372 AGTTCCTTGCAGGTTCTGCAGGG - Intergenic
953452191 3:43014561-43014583 AGTTGCAGGAAGGGGCTGCAGGG + Intronic
954139024 3:48595481-48595503 ATTTCCCAGAAGGTTCTGCATGG + Intergenic
955870714 3:63435619-63435641 AATTCCATGGAGATGCTCCAGGG - Intronic
955902282 3:63769819-63769841 ACCTCCATGAAGGTGTTCCCGGG + Intergenic
959972784 3:112426097-112426119 ACATCCATGAGGGTATTGCATGG - Intergenic
961321249 3:126078048-126078070 ACCTCCCTGAAGGACCTGCAGGG + Intronic
961499478 3:127321768-127321790 ACTTCCCTCAAGGTTATGCATGG + Intergenic
962572269 3:136723715-136723737 ACTTCCAAGTAGGTGCGGCCAGG - Intronic
962739377 3:138351730-138351752 ACTTCCAGCAAGTTCCTGCATGG + Intronic
964478734 3:157120836-157120858 GCATCCCTGAAGGGGCTGCAGGG - Intergenic
970655562 4:18226760-18226782 ACCTTCATGAAGGGGCTGCAGGG - Intergenic
972449686 4:39183945-39183967 ACTTGCATGAAGGAGTTCCAGGG + Intronic
973274488 4:48292786-48292808 ACTTCCCAGAAGGGGCGGCAGGG - Intergenic
975381772 4:73708540-73708562 ATTTTAATGAAGGTGCTTCAGGG + Intergenic
977394517 4:96454436-96454458 ACTTGCCTGAAGGTGCCCCATGG - Intergenic
978156990 4:105500680-105500702 ACTTCCAAGATGGGGCTGCCGGG + Intergenic
984231652 4:177107966-177107988 TCTTACATGAATGTGCTCCATGG - Intergenic
985570888 5:644096-644118 CCTCCCCTGAGGGTGCTGCAGGG + Intronic
990465939 5:56071597-56071619 ACTGCCAGGAAGCAGCTGCAAGG - Intergenic
990537491 5:56737029-56737051 ACTTGTACGAAGGTGCTGTATGG - Intergenic
991375051 5:65957773-65957795 ACTTCCCAGAAGGGGCGGCAGGG + Intronic
993256971 5:85604424-85604446 CCTGCCATGTAGCTGCTGCAGGG - Intergenic
995271087 5:110220306-110220328 TTTTCCATGAAGAAGCTGCATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996147758 5:119996389-119996411 CCTTACTTGAAGATGCTGCAAGG - Intergenic
1000446071 5:161322626-161322648 ACTAACATTAAGGTTCTGCATGG + Intronic
1001971697 5:175960392-175960414 AGTTACATGAAGGATCTGCATGG + Intronic
1002245745 5:177883385-177883407 AGTTACATGAAGGATCTGCATGG - Intergenic
1004167232 6:13267457-13267479 ACTTCCATGTGGCTGCTGAATGG + Exonic
1005315530 6:24599520-24599542 ACCTACAGGAAGGTGCTGGAGGG + Intronic
1006378221 6:33683509-33683531 ACTTCCAGGAAGGGGCTGGTTGG + Intronic
1006822769 6:36911577-36911599 ATTTGTATAAAGGTGCTGCATGG - Intronic
1007841138 6:44716697-44716719 TCTTCCATGGAAGTGCTCCAGGG - Intergenic
1009383892 6:63066422-63066444 ACTTCAATGCAGTTGCAGCAGGG + Intergenic
1011579194 6:88840115-88840137 ACTTCCCTGAAAATGCTGTAAGG + Intronic
1011696995 6:89921827-89921849 ACTCCCAGGAAGCTCCTGCAGGG - Intergenic
1015741900 6:136465053-136465075 ACTTTCATGAATGAGCAGCAGGG + Intronic
1017028932 6:150204039-150204061 ATCTTCATGTAGGTGCTGCACGG + Intronic
1018257091 6:161931460-161931482 AGTTCCAAGAAGGTACTGGAAGG + Intronic
1020545249 7:9520286-9520308 ACTTACCTGAAGGTGCAGGATGG + Intergenic
1023545705 7:41315987-41316009 GCTGCCTGGAAGGTGCTGCATGG + Intergenic
1026738096 7:72961500-72961522 ACTCCCAAGAAGGTGATCCAAGG - Intronic
1026789133 7:73320297-73320319 ACTCCCAAGAAGGTGATCCAAGG - Intronic
1027105638 7:75403568-75403590 ACTCCCAAGAAGGTGATCCAAGG + Intronic
1033810912 7:145009899-145009921 GCTTCCACGAAGGTGATGCAGGG - Intergenic
1035738428 8:1906786-1906808 ACGTTCATTAAGCTGCTGCAGGG + Intronic
1036079301 8:5536731-5536753 ATAACCAAGAAGGTGCTGCAGGG - Intergenic
1039742203 8:40393187-40393209 GCTGCCTTGAAGGGGCTGCAGGG + Intergenic
1040762265 8:50863352-50863374 ACTTCTGTGACGGTGCTGGAGGG - Intergenic
1043559185 8:81470469-81470491 ACTTTCCTGAAGTTGCTTCAGGG + Intergenic
1043919724 8:85967301-85967323 ACTTACATGATAATGCTGCACGG - Intergenic
1047055872 8:121164631-121164653 GCTTCCATGTAGTTGCAGCAAGG + Intergenic
1048752946 8:137700172-137700194 GCTTCCAAGAAGCTTCTGCAGGG - Intergenic
1049439156 8:142601347-142601369 ATTTCCCTGCAGGTGCTGAAAGG + Intergenic
1053407645 9:37891293-37891315 ACTTCCCAGAAGGGGCTGCCGGG - Intronic
1056437019 9:86584537-86584559 ACTTCCATGAAACTGTTGGAGGG + Intergenic
1057914605 9:99046209-99046231 ATTTGCATGAAGGTGCTGTGTGG + Intronic
1062349166 9:136130757-136130779 ACTGCCAAGAAGGGGGTGCAGGG - Intergenic
1186255604 X:7715195-7715217 ACTTCCATGAGAGTGTTGCTCGG + Intergenic
1188381408 X:29497448-29497470 TCTTCCATGTAGGAGCTACATGG + Intronic
1188535367 X:31190854-31190876 ACTTCCCTGAGAGTCCTGCAAGG + Intronic
1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG + Intergenic
1192361598 X:70444524-70444546 ACTTCCAAGAGGGAGTTGCAGGG - Intergenic
1197766834 X:130064851-130064873 TTTTGCATAAAGGTGCTGCATGG - Intergenic
1199366051 X:146984959-146984981 AGTTCTATGAAAGTGATGCAAGG + Intergenic
1200697435 Y:6373457-6373479 TCTTCCATGGAGGTGCATCAGGG - Intergenic
1200707919 Y:6458526-6458548 ACCTCCATGAAGATGCTTCACGG - Intergenic
1201026193 Y:9706182-9706204 ACCTCCATGAAGATGCTTCACGG + Intergenic
1201036678 Y:9791242-9791264 TCTTCCATGGAGGTGCATCAGGG + Intergenic
1202301723 Y:23422615-23422637 ACTTCCTTGTAGATACTGCATGG + Intergenic
1202331158 Y:23754517-23754539 AATTCTTTGAAGGAGCTGCAAGG - Intergenic
1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG + Intergenic
1202569088 Y:26247983-26248005 ACTTCCTTGTAGATACTGCATGG - Intergenic