ID: 1109734496

View in Genome Browser
Species Human (GRCh38)
Location 13:66464455-66464477
Sequence ACACTGGTTCTCTCATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109734496_1109734499 29 Left 1109734496 13:66464455-66464477 CCCTGCTATGAGAGAACCAGTGT 0: 1
1: 0
2: 1
3: 21
4: 174
Right 1109734499 13:66464507-66464529 GTTTATATAATTGACTTTACTGG 0: 1
1: 0
2: 2
3: 23
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109734496 Original CRISPR ACACTGGTTCTCTCATAGCA GGG (reversed) Intronic
902107938 1:14053195-14053217 CCACTGGCTCTCTCACAACATGG - Intergenic
902505062 1:16934231-16934253 CCACTGGTTATCTAATAGTAAGG - Intronic
904780083 1:32939948-32939970 ACTCTGGTTGTCTCTTATCAGGG - Intronic
907773699 1:57491537-57491559 ACAATGGTTGTCATATAGCAGGG + Intronic
908151215 1:61304914-61304936 ATAGTGCTTGTCTCATAGCAGGG + Intronic
911257140 1:95645910-95645932 ATACTGTTTCTCCCATAGCCAGG - Intergenic
911980608 1:104560866-104560888 GTACTGTTTCTCCCATAGCAAGG + Intergenic
913136652 1:115897264-115897286 AAACTGGTTCTCTAAGAGTACGG + Intergenic
913975718 1:143452930-143452952 ACACTGGTTCTTTCCAAGGAAGG + Intergenic
914070113 1:144278547-144278569 ACACTGGTTCTTTCCAAGGAAGG + Intergenic
914109042 1:144687807-144687829 ACACTGGTTCTTTCCAAGGAAGG - Intergenic
916323887 1:163535620-163535642 ACACTGTTCCTCTCAGGGCAGGG - Intergenic
918755521 1:188336378-188336400 GTACTGTTTCTCCCATAGCAAGG - Intergenic
919126503 1:193400647-193400669 ACACTGCTTGGCTCATAGTAAGG + Intergenic
920831975 1:209473622-209473644 TCACTGGTTCTCTCATAAACAGG - Intergenic
920960006 1:210655610-210655632 ACAGAGGTTCCCTCAGAGCAGGG + Intronic
921108540 1:212009486-212009508 TCCCTGGTTCTCTCACTGCAGGG + Intronic
921426654 1:215010512-215010534 AGTCTGTTTCTCTCATAGGAGGG - Intronic
921483430 1:215689642-215689664 TCACAGGCCCTCTCATAGCATGG - Intronic
921562745 1:216677818-216677840 ACACTGGTTCTCCAAGAGAAAGG - Intronic
921660740 1:217798667-217798689 ACACTGGCTCTCTCTTTGGAGGG - Intronic
922994384 1:229944326-229944348 CCACTGGTTCTCTGATTGCCCGG + Intergenic
1067982392 10:51101211-51101233 ACACTAATTCTATCATATCAGGG - Intronic
1072475371 10:95755146-95755168 ATACAGTTTCTCTCACAGCATGG - Intronic
1072598856 10:96903828-96903850 ACAATGTTTCTCTCACAGAAAGG - Intronic
1075475097 10:122727591-122727613 ACAGTGCTTCTCTCAGAGCATGG - Intergenic
1075523567 10:123162215-123162237 CCTCTGGTTCTCTCTTGGCAGGG + Exonic
1076189218 10:128470876-128470898 ACACTTGTTCTGTCAGAGCGCGG + Intergenic
1076772415 10:132673391-132673413 ATACTGTTTCTCCCATAGCCAGG - Intronic
1077957456 11:7036241-7036263 GCACTGTTTCTCTTATAGGAAGG - Intronic
1081546589 11:44076126-44076148 AAACTAGTGCTCTCTTAGCATGG + Intronic
1083520346 11:63304907-63304929 ACACTGCTTCTCTCAGGACATGG - Intronic
1084829736 11:71759748-71759770 ACTCTGGCTCTCTCCTACCAGGG + Intergenic
1085725546 11:78951698-78951720 ACACTGGTTCTATCTGATCAGGG + Intronic
1085748523 11:79136995-79137017 GCACTGTTTCTCCCATAGCCAGG + Intronic
1085972076 11:81605269-81605291 ACACTGGTTCCTTGATAGCATGG - Intergenic
1089903811 11:122015030-122015052 GCACTGTTTCTCCCATAGCCAGG + Intergenic
1094686055 12:32715901-32715923 ACACTGGTTCTCACTTAACATGG - Intronic
1094686136 12:32716883-32716905 ACACTGGTTCTCACTTAACATGG + Intronic
1095739022 12:45587001-45587023 GTACTGTTTCTCTCATAGCCAGG + Intergenic
1097554776 12:61123025-61123047 ATACTGTTTCTCCCATAGCCAGG + Intergenic
1098731293 12:74039113-74039135 ATACTGTTTCTCCCATAGCCAGG + Intergenic
1098831725 12:75372612-75372634 GCACAGTTTCTCTCATAGCCAGG - Intronic
1100917480 12:99442088-99442110 ACACTGGTTCTCTCATATGAAGG - Intronic
1105223521 13:18356807-18356829 ACACTGGTTCTTTCCAAGGAAGG - Intergenic
1105357071 13:19668425-19668447 AAACTGGTTCTAGCAGAGCAAGG - Exonic
1109734496 13:66464455-66464477 ACACTGGTTCTCTCATAGCAGGG - Intronic
1111057602 13:82971609-82971631 ATACTGTTTCTCCCATAGCCAGG - Intergenic
1112682315 13:101780892-101780914 ACACTGGAGCTCTTAGAGCAAGG - Intronic
1113737444 13:112689172-112689194 ACACTTGTTCTCTAATTCCACGG - Intergenic
1114766507 14:25377304-25377326 ACACTAATTCTATCATATCAGGG + Intergenic
1117527429 14:56623630-56623652 ACAGTTATTCTCACATAGCAAGG + Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1120498217 14:85262175-85262197 GTACTGTTTCTCTCATAGCCAGG - Intergenic
1121945933 14:98122060-98122082 ACACATGTTCTCTAAGAGCAGGG - Intergenic
1123100125 14:105791988-105792010 ACCCTGGCTCTCTCCTTGCAGGG + Intergenic
1123438563 15:20273256-20273278 AGACTGTTTCTTTCTTAGCATGG - Intergenic
1123996017 15:25718521-25718543 ACCCTTGCTCTCTAATAGCAAGG + Intronic
1124411240 15:29439117-29439139 ACCCTGGTTTTCTAATACCAAGG + Intronic
1126078606 15:44937248-44937270 ACACTGGTTGTCTCTTGGGAGGG - Intergenic
1126079242 15:44943077-44943099 ACACTGGTTGTCTCTTGGGAGGG + Intergenic
1126865791 15:52935402-52935424 ACACTGATTCTATCAGATCAGGG + Intergenic
1127356972 15:58209653-58209675 GCACTGTTTCTCCCATAGCTAGG + Intronic
1129326239 15:74801643-74801665 AGACTGGGGCTCCCATAGCAGGG - Intronic
1129833774 15:78688623-78688645 ACACTGGTTGTCTCTTGGGAGGG - Intronic
1130960699 15:88657032-88657054 GCAGTGCTTCTCTCATAGCATGG - Intergenic
1133512356 16:6472239-6472261 ACACTGCTTCTCTCACAGCCTGG - Intronic
1134843407 16:17419891-17419913 CCACTGGGTCACTCATAGCAAGG + Intronic
1135389629 16:22079699-22079721 ACAGTGGTTATCTCTTATCATGG - Intronic
1137904879 16:52310902-52310924 GCACTTGTTCTCCCAGAGCAAGG + Intergenic
1138163384 16:54777097-54777119 ACACTGCTTCTCTCAACCCATGG + Intergenic
1141578238 16:84979316-84979338 ACTCTGGTTTCCTCAGAGCATGG - Intronic
1146541436 17:33699158-33699180 ACACTGGTTCTCTCCTCACAAGG + Intronic
1148185013 17:45636552-45636574 ACACTGCTTTTCTTATGGCATGG - Intergenic
1152686114 17:81694566-81694588 ACCCTGTTCCTCCCATAGCAAGG + Intronic
1153272654 18:3338363-3338385 ACTGTGGTTGTCTAATAGCAGGG - Intergenic
1153481776 18:5554528-5554550 ACACTGGTTCCCTCCAACCATGG + Intronic
1154068661 18:11132504-11132526 GTACTGTTTCTCTCATAGCCAGG + Intronic
1156048251 18:32901492-32901514 GCCCTGGTTCTCTCATTTCAAGG + Intergenic
1158639113 18:59188215-59188237 ACACTGGACCTCTCCTATCATGG - Intergenic
1165034521 19:33023108-33023130 AGACTGTTTCTTTCTTAGCATGG - Intronic
1165300751 19:34967044-34967066 ACTCTGTTTCTCCCATGGCATGG + Intergenic
925283472 2:2701158-2701180 ATTCTGGTTCTCTCAGAGAAGGG + Intergenic
925439041 2:3868121-3868143 ACACCTGTTCTCTCAAAGGATGG + Intergenic
926476615 2:13330124-13330146 ACACCAGTTCTCTCAGATCAGGG + Intergenic
930480979 2:51947849-51947871 GCACTGTTTCTCGCATAGCCAGG - Intergenic
931806403 2:65811109-65811131 ATACTGGTTTTCTCTTAGGAGGG + Intergenic
932368887 2:71171485-71171507 ACACTGGTTGTCTCTTGGGAGGG - Intergenic
933504590 2:83161356-83161378 GTACTGTTTCTCTCATAGCCAGG - Intergenic
933653615 2:84869592-84869614 ACACTGGTTGTCACAGGGCATGG - Intronic
934180418 2:89613902-89613924 ACACTGGTTCTTTCCAAGGAAGG + Intergenic
934290718 2:91688165-91688187 ACACTGGTTCTTTCCAAGGAAGG + Intergenic
936055289 2:109257878-109257900 ACACTGCTTCTCTGACACCAGGG + Intronic
936729386 2:115361626-115361648 TCACAGGATCTCTCATAGCTAGG + Intronic
937785012 2:125886308-125886330 GTACTGCTTCTCTCATAGCCAGG - Intergenic
940171119 2:150831286-150831308 ATACTGTTTCTCCCATAGCCAGG - Intergenic
944526178 2:200622283-200622305 ACACTGCTTCTCACATTGCAGGG + Intronic
948042795 2:234916995-234917017 ACAGTGGGTCCCTGATAGCAAGG + Intergenic
1173127686 20:40354994-40355016 ACCCTGATTCTCTGAGAGCAAGG - Intergenic
1176732063 21:10509187-10509209 ACACTGGTTCTTTCCAAGGAAGG - Intergenic
1177505375 21:22012802-22012824 GTACTGTTTCTCTCATAGCCAGG - Intergenic
1179829390 21:43986987-43987009 ACACAGGTCCTCGCACAGCACGG - Intergenic
1181373526 22:22437763-22437785 GCACTGTTTCTCCCATAGCCAGG - Intergenic
1184433328 22:44454414-44454436 ACACTGGATGTCCCATAGCAAGG - Intergenic
1184603362 22:45556945-45556967 GCACTGTTTCTCCCATAGCCAGG - Intronic
1184800012 22:46753346-46753368 ACACTGGTTCTTCCAAAGGAGGG - Intergenic
952029849 3:29128598-29128620 ACTCTGTTTCTCTGATATCATGG - Intergenic
954857562 3:53659583-53659605 ACACAGGTTCTGTAACAGCAAGG - Intronic
955025953 3:55167570-55167592 ATAGTGTTTCTCTCATAGAAAGG + Intergenic
955200003 3:56843079-56843101 AAACTGGTTCTCTCTGAGGAGGG - Intronic
956703711 3:71981482-71981504 GCACTGTTTCTCCCATAGCCAGG - Intergenic
957404597 3:79761402-79761424 ACACTGGTTACCTCTTAGAAGGG + Intronic
958258823 3:91355312-91355334 ATACTGTTTCTCCCATAGCCAGG - Intergenic
960349704 3:116577119-116577141 ACACTGTTTCTCCCATAGCCAGG + Intronic
967506649 3:190260168-190260190 ACACAGGTTCATTCATAGCCAGG - Intergenic
976066712 4:81196069-81196091 TCACAGGCCCTCTCATAGCATGG - Intronic
977031836 4:91893223-91893245 GCACTGTTTCTCCCATAGCCAGG + Intergenic
978502970 4:109428675-109428697 ACACTGATCCTCTCATCACATGG - Intergenic
979072100 4:116221222-116221244 TCTCTGATTCTCTCATTGCATGG + Intergenic
979191177 4:117860481-117860503 AAACTGGGTCTCTCATATCAGGG + Intergenic
980405701 4:132352370-132352392 GTACTGTTTCTCTCATAGCCAGG - Intergenic
980957925 4:139447332-139447354 ATACTATTTCTCTCATAGCCAGG + Intergenic
980993236 4:139757142-139757164 GCCCTGATTCTCTCATAGCTTGG - Intronic
981835192 4:149045355-149045377 ATACTGTTTCTCCCATAGCCAGG + Intergenic
981873727 4:149516616-149516638 GCACTGTTTCTCCCATAGCCAGG + Intergenic
983311619 4:166070796-166070818 CCACTGTTTCTCTCATGGAATGG + Intronic
983582876 4:169326232-169326254 ATACTGTTTCTCCCATAGCCAGG + Intergenic
988267561 5:28971930-28971952 CTACTGTTTCTCTCATAGCCAGG - Intergenic
991453583 5:66778890-66778912 TCCCTAGTTCTCTCATAGCATGG + Intronic
993860802 5:93134561-93134583 ACAATGATTCTATCATAGGATGG + Intergenic
994166761 5:96616917-96616939 CCTCTGGTTCTCTCATGGCAGGG + Intronic
994544126 5:101141080-101141102 AAACTGGTTCTCTAAGAGCAAGG - Intergenic
995427548 5:112042333-112042355 ATACTGTTTCTCCCATAGCCAGG - Intergenic
996392022 5:122972372-122972394 CTACTGCTTCTCTCATAGCCAGG - Intronic
997886790 5:137637441-137637463 TCACTGCTTCTCACACAGCAGGG - Intronic
1000299197 5:159940005-159940027 AGACTGGGTCTCACCTAGCATGG + Intronic
1000382322 5:160640207-160640229 ACACAGGCACTCTCGTAGCATGG - Intronic
1003333672 6:5150985-5151007 ACACTAGTACTCTCATGGCATGG + Intronic
1004184785 6:13412655-13412677 ACGCTGGTTCTCCCATCCCAGGG - Intronic
1008340444 6:50357698-50357720 ACACTGTTTCTCCCATAACCAGG + Intergenic
1008400464 6:51056852-51056874 ATACTGTTTCTCCCATAGCCAGG + Intergenic
1008638973 6:53442142-53442164 CCCCTCTTTCTCTCATAGCATGG - Intergenic
1008860651 6:56145563-56145585 ACATTGGTTGACTCATAGCAGGG + Intronic
1008996432 6:57665261-57665283 ATACTGTTTCTCCCATAGCCAGG + Intergenic
1009184946 6:60564054-60564076 ATACTGTTTCTCCCATAGCCAGG + Intergenic
1013053614 6:106561653-106561675 AGACTGGTTCTATCAGAGCTAGG - Intronic
1013500623 6:110746667-110746689 ACACTGTATCTCACCTAGCATGG + Intronic
1014826770 6:126055952-126055974 ACAGTGGTTGTCTCAAGGCAGGG - Intergenic
1015475946 6:133658902-133658924 ATACTGTTTCTCCCATAGCCAGG + Intergenic
1019889352 7:3933621-3933643 ACACTGATTATCTAAAAGCATGG + Intronic
1027601885 7:80249440-80249462 ACAATTGTACTATCATAGCATGG + Intergenic
1029997439 7:105021403-105021425 CTACGGGTTCTCTCAAAGCAGGG - Intronic
1030883089 7:114905125-114905147 GTACTGTTTCTCTCATAGCCAGG - Intergenic
1031237048 7:119189677-119189699 ATACTGTTTCTCCCATAGCCAGG + Intergenic
1033521476 7:142165338-142165360 ACATTGGTCCTCTCATTGAAGGG + Intronic
1034597523 7:152212204-152212226 ACACTGGTTCTTTCCAAGGAAGG + Intronic
1035576759 8:712989-713011 ACATTTGTTCTCTCACAGCCCGG + Intronic
1036621683 8:10428142-10428164 CCACAGGTTCTTTCAGAGCACGG + Exonic
1036627363 8:10483215-10483237 GCACAGGTTCTTTCAGAGCATGG - Intergenic
1037037559 8:14186483-14186505 GCCCTGGTTCTTTCATAGGATGG + Intronic
1037364397 8:18106844-18106866 ATACTGTTTCTCCCATAGCCAGG - Intergenic
1038889082 8:31698298-31698320 ACACAGTTTCTCTCATGACAAGG + Intronic
1039323988 8:36465127-36465149 GCACTGTTTCTCCCATAGCCAGG - Intergenic
1039990696 8:42485181-42485203 TCACTGCTTCTCTCACTGCATGG + Intronic
1041100859 8:54395553-54395575 ACACGGGTTCTATCAGGGCAGGG - Intergenic
1044486973 8:92765764-92765786 GCACTGTTTCTCCCATAGCCAGG - Intergenic
1044690962 8:94878029-94878051 AGAGTAGTTCTATCATAGCAGGG - Intronic
1046129963 8:109954696-109954718 AAACTGGTTCTCTCATTCCCAGG + Intergenic
1046948477 8:119997677-119997699 GCACTGGTGCTCTCTTAGTAGGG + Intronic
1047453804 8:124990723-124990745 ATACTGTTTCTCCCATAGCCAGG + Intergenic
1047964579 8:130036454-130036476 AGACTGGTTATCTCAGAGGAGGG - Intergenic
1048813429 8:138309165-138309187 ACACTGGTTCACGCAGGGCAGGG + Intronic
1049538709 8:143195552-143195574 ACACTGTTTCTCCCATAGCCAGG + Intergenic
1050485759 9:6133063-6133085 TCAGTGGTTCTGTCATAGCTGGG - Intergenic
1051166261 9:14265391-14265413 ACACTAGTTCTGTCATATTAGGG - Intronic
1051902092 9:22054637-22054659 ACACAGGTTTTCACATAGAAAGG - Intergenic
1052071673 9:24089628-24089650 CCTCTGCTTCTCTCAGAGCATGG - Intergenic
1056722479 9:89083527-89083549 ACACTATTTCTATCATATCAGGG - Intronic
1056770541 9:89475182-89475204 ACACTGGTTCTCACAAAGCCTGG - Intronic
1057607985 9:96515451-96515473 TCACTGTTCCTCTCATAGAAAGG - Intronic
1057674526 9:97128531-97128553 ATCCTGGTTCACTCATAACATGG + Intergenic
1058259076 9:102808269-102808291 GTACTGTTTCTCTCATAGCCAGG - Intergenic
1060159160 9:121344288-121344310 AGCCTGCTGCTCTCATAGCAGGG - Intronic
1062286822 9:135777007-135777029 ACACACGTTTTCTCAGAGCAGGG - Intronic
1187514416 X:19954156-19954178 ACAATGGCTCTCTCAAAGCAAGG + Intronic
1191988177 X:67004440-67004462 GTACTGTTTCTCTCATAGCCAGG - Intergenic
1192069254 X:67919288-67919310 TAAGTGGTTCTCTCATAACATGG - Intergenic
1192267952 X:69553007-69553029 GCACCAGTTCTCTCATATCAGGG + Intergenic
1192270256 X:69572571-69572593 ACACAGGTTCTTCCATAGTAGGG + Intergenic
1192661390 X:73046370-73046392 CTACTGCTTCTCTCATAGCCAGG - Intergenic
1192699915 X:73457966-73457988 TCACTGGGTCTCTCATATCATGG + Intergenic
1194626762 X:96234408-96234430 GTACTGTTTCTCTCATAGCCAGG + Intergenic
1196140476 X:112256287-112256309 ACAATGGTTCTTTCAGGGCAAGG - Intergenic
1196372486 X:114995167-114995189 GTACTGTTTCTCTCATAGCCAGG - Intergenic
1197371869 X:125636449-125636471 ATACTGTTTCTCCCATAGCCAGG - Intergenic
1197386597 X:125810838-125810860 ATACTGTTTCTCCCATAGCCAGG - Intergenic
1199974337 X:152884092-152884114 ACACTGGCTGTCTCATGGGAAGG + Intergenic