ID: 1109739458

View in Genome Browser
Species Human (GRCh38)
Location 13:66533042-66533064
Sequence GCCACTTATGTGCCCACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109739453_1109739458 18 Left 1109739453 13:66533001-66533023 CCTTACGGTCTTAGCAACACATC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109739458 Original CRISPR GCCACTTATGTGCCCACACT GGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
904964254 1:34359473-34359495 GCCACTCATGTCCCCTCTCTGGG + Intergenic
905867847 1:41385972-41385994 GGCACTTGTGTGGGCACACTTGG - Intergenic
915013564 1:152712643-152712665 CCCACATATGTGCACACAGTGGG + Intergenic
920441044 1:205980579-205980601 GCCACTGAGGTGGCCAGACTGGG - Intronic
922061777 1:222099584-222099606 TCCATTTATGGGCTCACACTAGG - Intergenic
922112011 1:222568601-222568623 TCCACATCTGTGCCAACACTTGG - Intronic
924565796 1:245197104-245197126 ACCAATTATTTGCCCACAGTAGG + Intronic
1066298528 10:34076653-34076675 GCCATTTCTGTGTCCTCACTTGG - Intergenic
1067152982 10:43751790-43751812 GGCACTTATGTTCACACACCAGG + Intergenic
1069049285 10:63775722-63775744 GCCTCTTACCTGCCCACTCTAGG + Intergenic
1074108937 10:110408947-110408969 GCTACTAATGTTCCCACACAGGG + Intergenic
1077267654 11:1660012-1660034 GCCACTGAGGTGCCCACAAAGGG + Intergenic
1077308524 11:1878394-1878416 GCCACTTAATTCCCCACACCTGG - Intronic
1077579867 11:3409974-3409996 GCCACATCTGTGGACACACTCGG - Intergenic
1080966419 11:37219181-37219203 ACCACTATTGTGACCACACTGGG + Intergenic
1081609658 11:44553170-44553192 GCCATTTAGGTGCCCTCACATGG - Intergenic
1086613378 11:88784345-88784367 TCCACTTATGTGCCCACCATAGG + Intronic
1088884292 11:113994820-113994842 CCTACTTATGTGCTCACACCTGG + Intergenic
1089635050 11:119806734-119806756 TGCACTCATGAGCCCACACTGGG - Intergenic
1089774782 11:120828611-120828633 GGCACTCATGTCCCCAGACTGGG + Intronic
1090236725 11:125153723-125153745 GCCAATTATGTGCTGTCACTGGG - Intergenic
1091704206 12:2682710-2682732 CCCACATTTGTTCCCACACTTGG - Intronic
1091856440 12:3744392-3744414 GACACTAATGTGCCCAGACAGGG + Intronic
1100180324 12:92078341-92078363 GAGACTAATGTTCCCACACTAGG - Intronic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1104971894 12:132534537-132534559 GCCCCACATGTGCCCACACAGGG + Intronic
1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG + Intronic
1111198079 13:84899020-84899042 GCCACTTGTGTGTACCCACTAGG + Intergenic
1113786019 13:113002434-113002456 GCCACTGCTGTCCCCACAATGGG + Intronic
1114754541 14:25244926-25244948 GCCAGATATGTGCCCACCTTTGG - Intergenic
1117264855 14:54076404-54076426 GCCACTTCTGTACCCACCCAGGG - Intergenic
1119781325 14:77278343-77278365 GGCACTGCTGAGCCCACACTGGG + Intronic
1121000892 14:90451463-90451485 CGCACTTATGTGTCCACATTTGG + Intergenic
1122412069 14:101530716-101530738 GCCACCCATGTGCCCATCCTGGG + Intergenic
1122651786 14:103230443-103230465 GCCAGGTCTGTGCCCACAATGGG + Intergenic
1122817144 14:104319385-104319407 CCCAGTTCTGTGCCCACACCAGG - Intergenic
1127322384 15:57859452-57859474 TCTACTGCTGTGCCCACACTAGG - Intergenic
1129454654 15:75670267-75670289 GCCACTGCTGTGCCCATGCTGGG - Intergenic
1132078059 15:98839417-98839439 GCCACATATATGCTCACACTGGG + Intronic
1132740629 16:1410721-1410743 GCCCCTTATCTGCCCAGACCTGG - Intronic
1144239453 17:13295925-13295947 GACAATTATGTCCCCAGACTAGG + Intergenic
1144398765 17:14873736-14873758 GCCAATTATGTGTCAACACCAGG - Intergenic
1145272829 17:21413728-21413750 GCCACTGACGTGCCCACCCCCGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1151269646 17:72984276-72984298 GCTACTTCTGTGCCCATCCTGGG - Intronic
1151473186 17:74330654-74330676 GCCCATTGTGTGCCCACACACGG + Intronic
1152635337 17:81428509-81428531 GCCACTTCTGGGCCCTGACTAGG - Intronic
1154502544 18:15003913-15003935 GCATCTAATGTCCCCACACTTGG - Intergenic
1157126237 18:44959080-44959102 GCCATTTATCTTCCCACAGTTGG + Intronic
1161951631 19:7470923-7470945 GCCACTGATGTTCCCTCAGTGGG - Exonic
1163935601 19:20440378-20440400 GTCACTTGTATGCCAACACTTGG - Intergenic
1164913953 19:32034920-32034942 GTCACTCTTGTGCCCTCACTGGG - Intergenic
1165090978 19:33388332-33388354 GCCACCCATGTGCACACACCCGG + Intronic
1167676018 19:50886395-50886417 GACACATATGTGACCACACAAGG - Intergenic
927880618 2:26687669-26687691 GCCACTTAGGAGGCCACTCTAGG + Intergenic
931969195 2:67567161-67567183 CCCACTGATCTACCCACACTGGG - Intergenic
934898955 2:98141921-98141943 GCCACTTAGGGGGCCTCACTTGG - Intronic
934991415 2:98924604-98924626 GCTAATTATGTGCTCACGCTGGG + Intronic
935235982 2:101138707-101138729 GGCACTTCTGTGCCCTCTCTGGG + Intronic
938317033 2:130337118-130337140 GCCACTTTTGTTCCCATACCGGG + Intergenic
944105293 2:196073119-196073141 CCCACTTCTGTGGCCACACTGGG - Intergenic
949041056 2:241850156-241850178 GCCCCCCATGTGCCCACCCTGGG - Exonic
1172956152 20:38760808-38760830 GCCAATTATCTTCCCAAACTTGG - Intronic
1174382971 20:50169231-50169253 GCCACCCATGTGCCCTCTCTGGG + Intergenic
1175395880 20:58661235-58661257 ACCACTTATGTGCCCCTCCTTGG - Intronic
1175494597 20:59404849-59404871 GCCACTAATGGAGCCACACTGGG + Intergenic
1175894606 20:62330577-62330599 ACCACCCATGTGCCCACGCTGGG - Exonic
1179788393 21:43741996-43742018 CCCACTCCTGTGACCACACTGGG + Intronic
1181271273 22:21660257-21660279 GCCATATATGTGGCCACACAGGG + Intronic
1184255981 22:43287215-43287237 TCCTCCTCTGTGCCCACACTGGG - Intronic
949684365 3:6551282-6551304 TCCACTAATGAGGCCACACTGGG - Intergenic
950494946 3:13328184-13328206 GGCAATTATGTGCGCACACACGG + Intronic
955081384 3:55660711-55660733 AGCACTTATGTGCACAGACTTGG + Intronic
958936292 3:100259882-100259904 GCCACCTATGTGGCCACCTTGGG + Intergenic
960946644 3:122971404-122971426 GGCACTAATGTGCCCACTCATGG + Intronic
962867087 3:139456024-139456046 ACCACTTCTGTGCCCAAATTAGG + Intronic
968662344 4:1803975-1803997 GCCAACTTTGTCCCCACACTGGG - Intronic
975492564 4:75004742-75004764 GTCACTTAGTTGCCCACACTAGG + Intronic
979263883 4:118679297-118679319 GCCACTTATGGTCCTACTCTGGG - Intergenic
982077566 4:151753070-151753092 GCCACCTAAGTTCCCGCACTGGG + Intronic
989353559 5:40515863-40515885 ACCACTTCTCTGTCCACACTAGG - Intergenic
990488366 5:56280680-56280702 GCCCCATATGTCTCCACACTAGG + Intergenic
993092981 5:83449997-83450019 CACACATATGTGCCCACACATGG + Intergenic
993811129 5:92477475-92477497 GCCACATATATTCCCATACTAGG + Intergenic
994191559 5:96874986-96875008 GCCACTATGGTTCCCACACTAGG + Intronic
998396791 5:141823877-141823899 ACCCCTCATGTGCCCAAACTTGG - Intergenic
1006345552 6:33478966-33478988 ACCAGTGATGTGCACACACTGGG - Intergenic
1011509125 6:88080644-88080666 GACAGATCTGTGCCCACACTTGG + Intergenic
1016995887 6:149962443-149962465 GCCACTTCTATGCCCATCCTGGG + Intergenic
1017002695 6:150006725-150006747 GCCACTTCTATGCCCATCCTGGG - Intergenic
1017685718 6:156912429-156912451 TCCACTTTTGTGCCCACTCCAGG + Intronic
1019283384 7:211475-211497 GCCCCTCATGTGGCCACGCTGGG - Intronic
1026807610 7:73437830-73437852 GGCAGTAAAGTGCCCACACTGGG + Intergenic
1040419312 8:47224302-47224324 CACACTCATGTGCCCCCACTTGG + Intergenic
1040484236 8:47854993-47855015 GCCTCTGATGTCCCCACGCTGGG - Intronic
1046651907 8:116844739-116844761 GCCGCTTAGGTGCACGCACTTGG - Intronic
1051610077 9:18953014-18953036 GCCATTTCTGTGCTCACAATCGG + Intronic
1057044201 9:91872270-91872292 GCCACTCATGTAAACACACTCGG + Intronic
1057274713 9:93670214-93670236 GCCACTCCTGGGCCCATACTTGG - Intronic
1062497740 9:136839587-136839609 GCATCTCATGTCCCCACACTTGG + Intronic
1198301823 X:135340927-135340949 GTCAATTAAGTGCCCCCACTTGG - Intronic
1199578899 X:149341962-149341984 GCCACTTGTTGGCCCAAACTGGG - Intergenic
1200699548 Y:6390520-6390542 CCCACTTATGGTCCCACAGTGGG - Intergenic
1201034563 Y:9774178-9774200 CCCACTTATGGTCCCACAGTGGG + Intergenic
1201730861 Y:17201348-17201370 GCCAGTTTGGTGCCCACAGTGGG + Intergenic