ID: 1109741856

View in Genome Browser
Species Human (GRCh38)
Location 13:66563956-66563978
Sequence CTGTCGAAAGGGCTGTGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109741856_1109741867 28 Left 1109741856 13:66563956-66563978 CCTTACCACAGCCCTTTCGACAG 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1109741867 13:66564007-66564029 CCCAGGGGCTAAAATATGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 108
1109741856_1109741860 11 Left 1109741856 13:66563956-66563978 CCTTACCACAGCCCTTTCGACAG 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1109741860 13:66563990-66564012 TCATTACCCTTTGTATCCCCAGG 0: 1
1: 0
2: 1
3: 20
4: 166
1109741856_1109741861 12 Left 1109741856 13:66563956-66563978 CCTTACCACAGCCCTTTCGACAG 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1109741861 13:66563991-66564013 CATTACCCTTTGTATCCCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 152
1109741856_1109741862 13 Left 1109741856 13:66563956-66563978 CCTTACCACAGCCCTTTCGACAG 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1109741862 13:66563992-66564014 ATTACCCTTTGTATCCCCAGGGG 0: 1
1: 0
2: 4
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109741856 Original CRISPR CTGTCGAAAGGGCTGTGGTA AGG (reversed) Intronic
900414086 1:2527191-2527213 CCGTGGAAAGTGCTGTGGTCGGG + Intergenic
900584658 1:3426836-3426858 CTGGGGACAGGGCTGTGGTCTGG + Intronic
902142644 1:14369717-14369739 CTGGCACAAGGGCTGTGGTCAGG - Intergenic
903229182 1:21911557-21911579 CTGGGTAAAGGGCTGTGCTATGG - Intronic
903671576 1:25039101-25039123 CTCTCGGAAGAGCTCTGGTATGG - Intergenic
903970815 1:27117688-27117710 CTATCCCAAGGGCTGTGGTGAGG - Intronic
904468155 1:30719931-30719953 CTGTAAAAAGGGTTGTGGTGAGG + Intronic
904923624 1:34028700-34028722 CTGTCCACAGGGTTGTGGTGGGG + Intronic
906242892 1:44252803-44252825 CAGTGGGAAGGGCTGTGGTTGGG + Intronic
907880312 1:58543823-58543845 TTGTAGAAAGGTCTGTTGTATGG - Intronic
909144387 1:71911320-71911342 CTGTGGAAAGAGCTCTGGTCAGG + Intronic
912595656 1:110873214-110873236 CTGCCGAAAGGACTGAGGAACGG + Exonic
924244763 1:242073379-242073401 CTGTAGCAAGGGCTGTGGACAGG - Intergenic
924719767 1:246611182-246611204 CTGGGGAAAGGGGTGAGGTAAGG + Intronic
1067942347 10:50667675-50667697 CACTGGAAAGGGCTGTGGTTGGG - Intergenic
1068866065 10:61897057-61897079 CTGTCTCAAGAGCTGTGGTGGGG - Intergenic
1070863592 10:79692633-79692655 CACTGGAAAGGGCTGTGGTTGGG - Intergenic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1081591612 11:44427089-44427111 CTGGGGAAAGGGCTGTGGTCAGG + Intergenic
1083234486 11:61342879-61342901 CTTTGGAAAGGGCTGAGGGAGGG + Intronic
1086890769 11:92255429-92255451 CTGTGGCAAGGACTGTGCTAGGG - Intergenic
1091047903 11:132341352-132341374 CTGGCGAAAGTGATGTGGTGTGG - Intergenic
1093291767 12:17333481-17333503 CTGTCCAAAGGTCTGTGTCAGGG - Intergenic
1093775041 12:23063956-23063978 CTGTGGAGAGGCCTGCGGTAGGG - Intergenic
1096588965 12:52644590-52644612 CTTTCGGAAGTGCTGTGGTCTGG - Exonic
1101316357 12:103632576-103632598 ATGTCGAGAGGGCTGTGGGAAGG + Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1109741856 13:66563956-66563978 CTGTCGAAAGGGCTGTGGTAAGG - Intronic
1117081331 14:52155158-52155180 CTGTAGAAGGGGCTGTGGTCTGG - Intergenic
1120581713 14:86258762-86258784 CAGTTGAAATGACTGTGGTATGG + Intergenic
1124692052 15:31831952-31831974 CTGGCGGAAGGGCTGGGGCAGGG + Intronic
1124794741 15:32766700-32766722 CTGTCCAAACGGCTGAGGAACGG + Exonic
1130569406 15:85027190-85027212 CTGCAGAATGGGCTGTGGTCTGG + Intronic
1132035649 15:98481607-98481629 CTGTCTGAAGGGCTGCGTTAAGG - Intronic
1134659621 16:15974191-15974213 CTTTGGAAAGGGCTGTGCTTTGG + Intronic
1137036205 16:35572107-35572129 CTGTGGGAAGGGCTTTAGTAGGG + Intergenic
1139102634 16:63786925-63786947 CTTTAGAAAGGCCTGGGGTAGGG - Intergenic
1139209893 16:65067016-65067038 CTGTTGCAGGGGCTGTGGTGTGG + Intronic
1142876035 17:2852843-2852865 CTGGGGAAAGGGCTGTGGCCTGG - Intronic
1145795165 17:27651229-27651251 TTGTCCAAAGACCTGTGGTAGGG - Intergenic
1145915821 17:28573494-28573516 CTGGGCCAAGGGCTGTGGTATGG + Exonic
1147887005 17:43690992-43691014 CTGTCGAAAGGGGTCGGGTGGGG - Intergenic
1149835214 17:59906365-59906387 CTGTCGAAAGGGAAGGGGAAGGG - Intronic
1151769483 17:76150676-76150698 CTGTGGCAAGGGCTATGGAAAGG - Intronic
1152931382 17:83111869-83111891 CTTTTGAAAGGGCTGTGGCCAGG + Intergenic
1153130455 18:1850382-1850404 CTGTCTAAAGGTCTGAGATAGGG + Intergenic
1157569622 18:48703869-48703891 CTGCCAAAAGGGCTGTGGCCAGG + Intronic
1157747341 18:50147355-50147377 CTGTGGACAGGGCAGTGGCAGGG - Intronic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1164211160 19:23098499-23098521 CTGTGGACAGGGCTGAGGCAGGG - Intronic
1165351212 19:35276999-35277021 CTCTCGAGAGGACTGTGGGAGGG + Intronic
927719134 2:25372083-25372105 CTGTAGACCGGGCTGGGGTAAGG + Intergenic
927945650 2:27133710-27133732 CTGCAGAAAGTGCTGTGGGAGGG + Exonic
928914694 2:36458331-36458353 TTGCTGAAAGGGCTGTGGGAGGG + Intronic
931771708 2:65503278-65503300 CTGAAGAAAGTGCTGTGGAAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933171658 2:79132176-79132198 CTCTAGAAAGGACTGTGGAATGG + Intergenic
933699175 2:85242463-85242485 CTGTCATAACGGCTGTGGTCAGG - Intronic
933970436 2:87465533-87465555 CAGTCGGAAGGGCTTTGGTGTGG - Intergenic
936323347 2:111484963-111484985 CAGTCGGAAGGGCTTTGGTGTGG + Intergenic
941183385 2:162288659-162288681 TTGTAGAAAGGGCTGTGGTGCGG + Intronic
941275012 2:163480101-163480123 CACTCCAAAGGGCTATGGTAAGG + Intergenic
945198952 2:207262650-207262672 TTGTAGAAAGGGCTCTGGGAAGG + Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946345337 2:219105431-219105453 CTGTCAAAATGGATGTGGCAGGG - Intronic
1169901747 20:10560167-10560189 CTGTTGACTGGGCTGTGGTGTGG + Intronic
1170528292 20:17262995-17263017 CTGTCTACAGGCTTGTGGTAAGG + Intronic
1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG + Intronic
1173751469 20:45480045-45480067 CTGCCGCAATGGCTGTGGGAAGG + Exonic
1174195773 20:48771790-48771812 CTGCCCACAGGGCTGTGGTGAGG - Intronic
1176110109 20:63407236-63407258 CTGTCTTCCGGGCTGTGGTACGG + Exonic
1176342451 21:5710756-5710778 ATGTCGAAAGGGGCGTGGCAGGG - Intergenic
1176474705 21:7142908-7142930 ATGTCGAAAGGGGCGTGGCAGGG - Intergenic
1176502376 21:7613700-7613722 ATGTCGAAAGGGGCGTGGCAGGG + Intergenic
1176536772 21:8108825-8108847 ATGTCGAAAGGGGCGTGGCAGGG - Intergenic
1179405461 21:41122097-41122119 CTGTCGAGAGGGCTGAGGCCAGG - Intergenic
1181140778 22:20803339-20803361 CTGTCACATGGCCTGTGGTATGG + Intronic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1203241719 22_KI270733v1_random:25236-25258 ATGTCGAAAGGGGCGTGGCAGGG - Intergenic
955349940 3:58185893-58185915 CTGTCAGAAGGGAGGTGGTATGG - Intergenic
956458857 3:69451365-69451387 CTGTAGGAAGTGCTGTGATAAGG + Intronic
961659866 3:128462980-128463002 GTGTCGAAGGGGCTGTGGTAGGG + Exonic
963088024 3:141456236-141456258 CTGTGGATGGGGCTGGGGTAGGG - Intergenic
966285515 3:178290695-178290717 CTGTCAAAAGGGCTGTAATACGG - Intergenic
970311149 4:14783844-14783866 CTGTGGAAAGAGCAGTGGTATGG - Intergenic
970927999 4:21475381-21475403 ATGTGGAATGAGCTGTGGTACGG - Intronic
977691326 4:99914700-99914722 CTGTAGAAATTGCTGTGGTTTGG - Intronic
981961458 4:150544599-150544621 CTGTAGAAATTGCTGTGGCAAGG - Intronic
984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG + Intronic
989149247 5:38282483-38282505 CTGTGGGGAGGGCTGTGGGAAGG + Intronic
989262056 5:39429474-39429496 CTCTGGAAAGGTCTGTGGTGGGG + Intronic
989487164 5:42004781-42004803 CTGTAGAATGGGCGGTGGTGAGG + Intergenic
995731493 5:115247849-115247871 CTGTGAAAAGGTCTGTGGAATGG + Intronic
999148234 5:149409798-149409820 TTGCCCAAAGGGCTGTGGTGTGG - Intergenic
999472212 5:151865234-151865256 CTGAGGAAAGGGCTCTGATAGGG + Intronic
1007225620 6:40311740-40311762 TTGTGGCAAGGGCTGTGGGAGGG - Intergenic
1018364990 6:163110805-163110827 CTCTTGAAAGGGCCATGGTATGG + Intronic
1019959112 7:4442694-4442716 CTGTCAAAAGGGATCTGGTAGGG + Intergenic
1020781631 7:12523404-12523426 CTGTCGAAAGTCATGTGGTTTGG - Intergenic
1021172876 7:17417340-17417362 CTGTAGAAAGGGTTGGGGTTTGG - Intergenic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1030043222 7:105470748-105470770 CTGTCAAAAGGTGTGTGGAAGGG - Exonic
1030114070 7:106050047-106050069 CTGTTGAAAGAGCTGTGCTGCGG + Intergenic
1032165441 7:129541348-129541370 CTGGAGAAAGGGCTGTGGCCTGG + Intergenic
1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG + Intronic
1050284124 9:4083362-4083384 CTACCTAGAGGGCTGTGGTAAGG - Intronic
1050631220 9:7560793-7560815 CTGTTCCAAGGGCTGTGGGAAGG + Intergenic
1055936811 9:81611738-81611760 CTGTCGGGTGGGCTGTGGTTGGG - Intronic
1057743905 9:97736388-97736410 CTGTGGAAAATGCTGTGGTCAGG - Intergenic
1203458042 Un_GL000220v1:8311-8333 ATGTCGAAAGGGGCGTGGCAGGG - Intergenic
1189670632 X:43404680-43404702 CTGTGCAAAGGGCTGAGGAAGGG + Intergenic
1189736871 X:44080353-44080375 CTGCCGCAAGGGATGTGGTATGG + Intergenic
1190440455 X:50470499-50470521 CTCTGGACAGGGCTCTGGTATGG + Exonic
1196867937 X:120086355-120086377 CTGTCCCAAGGGCTGAGGAATGG - Intergenic
1196875165 X:120149926-120149948 CTGTCCCAAGGGCTGAGGAATGG + Intergenic
1197577517 X:128234490-128234512 GAGTCCAAAGGCCTGTGGTAAGG + Intergenic