ID: 1109743928

View in Genome Browser
Species Human (GRCh38)
Location 13:66595153-66595175
Sequence CATTTCAAAGAGATGTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 1, 2: 7, 3: 30, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109743928_1109743931 27 Left 1109743928 13:66595153-66595175 CCTGGGAACATCTCTTTGAAATG 0: 1
1: 1
2: 7
3: 30
4: 223
Right 1109743931 13:66595203-66595225 TTTTTCCACTTTCTGTGGGAAGG 0: 1
1: 0
2: 4
3: 49
4: 514
1109743928_1109743930 23 Left 1109743928 13:66595153-66595175 CCTGGGAACATCTCTTTGAAATG 0: 1
1: 1
2: 7
3: 30
4: 223
Right 1109743930 13:66595199-66595221 TTTTTTTTTCCACTTTCTGTGGG 0: 1
1: 2
2: 27
3: 247
4: 2287
1109743928_1109743929 22 Left 1109743928 13:66595153-66595175 CCTGGGAACATCTCTTTGAAATG 0: 1
1: 1
2: 7
3: 30
4: 223
Right 1109743929 13:66595198-66595220 ATTTTTTTTTCCACTTTCTGTGG 0: 1
1: 5
2: 17
3: 175
4: 1537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109743928 Original CRISPR CATTTCAAAGAGATGTTCCC AGG (reversed) Intronic
903092969 1:20939425-20939447 CATTTCAAACAAATGTACCATGG + Intronic
909546530 1:76854413-76854435 CATATCAAAGGCATGCTCCCAGG - Intergenic
909995866 1:82278455-82278477 CATATCTAAGGGCTGTTCCCTGG - Intergenic
911652927 1:100410255-100410277 CATTTCAAAGATATGTTTCTTGG - Intronic
911714533 1:101115801-101115823 CATTGTAAAGAGATGTTAGCTGG - Intergenic
912147108 1:106807510-106807532 TATTTCAAAGAGATGGCTCCAGG + Intergenic
913200878 1:116494530-116494552 TATTTCAATGAGTTCTTCCCGGG + Intergenic
916216814 1:162402663-162402685 CAGGTAAAAGACATGTTCCCAGG + Intronic
916856341 1:168754097-168754119 GATTTCAAAGATATTTCCCCAGG + Intergenic
919941924 1:202293620-202293642 AGTTGCAAAGACATGTTCCCTGG + Intronic
920537892 1:206752096-206752118 CATTTCAAAGAGATGGCTCCCGG + Intergenic
921109846 1:212024896-212024918 CCTTTCTATGAGATGTTCTCTGG - Intronic
921151525 1:212406863-212406885 CCTTTCATAGAGAAGTGCCCAGG - Intronic
922879479 1:228969873-228969895 CACTTCAAAAAGATGCTTCCTGG + Intergenic
923037248 1:230292886-230292908 CCTTTCCAAGAGCTGTTGCCTGG + Intergenic
924565678 1:245196248-245196270 CATTGCAAAGGGAAGTTCACAGG - Intronic
1062841483 10:676520-676542 CAGTTCAAAGAGATTTTTGCTGG - Intronic
1063652329 10:7950211-7950233 CTTTTCAAAGACATATTCTCTGG - Intronic
1063864100 10:10345281-10345303 CACATCAAAGAAATGTTCCCAGG + Intergenic
1064304321 10:14151745-14151767 CATTTCCAAGAAATGTTCCCTGG - Intronic
1066222267 10:33346724-33346746 TATTTTACAGAGATGCTCCCAGG - Intergenic
1066258936 10:33710196-33710218 CCTTTCAAACATATGTTCCGAGG + Intergenic
1066269877 10:33811747-33811769 CATTTAAAAAAGTTGTTCACTGG - Intergenic
1066685561 10:37978134-37978156 CATTTCAAAGACATGACCCAAGG + Intergenic
1067186827 10:44036293-44036315 CTTCTCAGAGAGATCTTCCCTGG + Intergenic
1067452677 10:46391972-46391994 CATTTGCAAGAGTTGTCCCCAGG - Intergenic
1067584555 10:47467783-47467805 CATTTGCAAGAGTTGTCCCCAGG + Intronic
1069348150 10:67494399-67494421 AATTTCAAAAGGATGTTTCCTGG + Intronic
1071398464 10:85245953-85245975 TATATCAAAGGCATGTTCCCAGG + Intergenic
1071695696 10:87867367-87867389 CTTTTCAAATAAATGTTCACAGG + Intronic
1072724897 10:97806600-97806622 CATAACCAAGAGAGGTTCCCAGG + Intergenic
1073160617 10:101391231-101391253 TAATTCAAAAAGATGTTCCAAGG - Intronic
1078548726 11:12265620-12265642 CATTTAAAACAGATGTTCCTGGG + Intergenic
1079997191 11:27306590-27306612 CATTTAAAAGAGAGGATCCAGGG - Intergenic
1080091694 11:28356120-28356142 CCTCTCAAAGAGGTCTTCCCTGG + Intergenic
1080570571 11:33552974-33552996 CATTTCCCAGGGATTTTCCCTGG - Intronic
1082695559 11:56360128-56360150 CAATTCAAAGAAATGTTATCAGG + Intergenic
1082881317 11:58041091-58041113 CAGTTCCAAGAGAAGTTCCAAGG + Intronic
1085241190 11:75057809-75057831 CATTTAATAGAGATGTTTCTTGG - Intergenic
1086048354 11:82559926-82559948 CAGTTCAGAGAGATGTTCTTAGG - Intergenic
1086900611 11:92363524-92363546 CATGTCAAAGAGAAGTTGCCAGG - Intronic
1088402964 11:109441387-109441409 CATTTTAAAGAGATGATCTTAGG + Intergenic
1089375355 11:117990013-117990035 CATTTCAAAGGGATGACCCCTGG - Intronic
1090100879 11:123795689-123795711 CATTTCAAAGAGATGGATCCTGG + Intergenic
1091107614 11:132937413-132937435 CATTAGAAATATATGTTCCCTGG - Intronic
1091579578 12:1775460-1775482 AATTTCAGAGTGATTTTCCCTGG - Intronic
1091948924 12:4575088-4575110 CATTTCTAAGATGTATTCCCAGG + Intronic
1095285340 12:40404043-40404065 CATGTCAAAGTGATGGTGCCAGG + Intronic
1096516179 12:52156859-52156881 CAGTGCAAAGAGCTGTTCCTGGG - Intergenic
1098049412 12:66437854-66437876 CTCTTCAAAGAGATGTTACCAGG - Intronic
1098633073 12:72748377-72748399 CATTTCAAAGAGATGGTCCCAGG + Intergenic
1098701022 12:73626260-73626282 CATTTCAAAGAGATGGCTTCTGG + Intergenic
1099891254 12:88591579-88591601 CATTTAAATGAGAAGTTCCTAGG + Intergenic
1100794996 12:98172523-98172545 GATTTCAAAAGCATGTTCCCTGG + Intergenic
1102466070 12:113131473-113131495 CATTTCAATGGGAGCTTCCCTGG + Intronic
1103954515 12:124568655-124568677 CTGTTCAAAGAGATCTGCCCTGG - Intergenic
1105979221 13:25501511-25501533 CATGTGAAAGACATATTCCCTGG + Intronic
1107105152 13:36635287-36635309 CACTGCAAAGATATGTTGCCTGG - Intergenic
1108095494 13:46896573-46896595 CATTTCAATGAGAATTTCCAGGG - Intronic
1108420796 13:50247172-50247194 CATTTCAAAGAGCATTTCACAGG - Intronic
1109620432 13:64897664-64897686 CATTTTAAAAAGATATTCCAGGG + Intergenic
1109743928 13:66595153-66595175 CATTTCAAAGAGATGTTCCCAGG - Intronic
1109866996 13:68277647-68277669 CATTTCAAAGAGATTTTACTAGG - Intergenic
1110509918 13:76337385-76337407 CATTTCAAAGACAGGTTCCCAGG + Intergenic
1110947266 13:81438042-81438064 CATTTAAATGATATTTTCCCTGG - Intergenic
1111030961 13:82597961-82597983 CATTTCAAAGAGATGGCTCCTGG + Intergenic
1111376986 13:87393173-87393195 CATTTCCAAAAGATCATCCCCGG - Intergenic
1111933513 13:94535976-94535998 CATCTTAAAGAGGTGTTCACAGG + Intergenic
1112132784 13:96542141-96542163 CATAAGAAAGAGATGGTCCCTGG + Intronic
1112437122 13:99398529-99398551 CATTTCAAAGAGATGGCTCCTGG - Intergenic
1112677649 13:101722065-101722087 CATATCATAGAGAGCTTCCCTGG + Exonic
1112716294 13:102190018-102190040 CATTTCAACGAGATGTTGAGGGG + Intronic
1116440448 14:44945732-44945754 TATTTCAAAGCTATGTTCACTGG - Exonic
1116812902 14:49556300-49556322 CATTTTGTAGAGATGTTGCCAGG - Intergenic
1117002275 14:51382931-51382953 CCATTAAAAAAGATGTTCCCAGG - Intergenic
1119370595 14:74138231-74138253 CTCTTCCAAGAGGTGTTCCCTGG - Intronic
1120481884 14:85060134-85060156 AATTTCAAAGTGATGTTCTTAGG + Intergenic
1121488783 14:94343117-94343139 CATGTCACAAACATGTTCCCAGG + Intergenic
1122490464 14:102111984-102112006 AATTTCAAAGTGATGTACCTTGG + Intronic
1123451658 15:20368177-20368199 AAATTCAGAGAGAAGTTCCCAGG + Intergenic
1123964852 15:25444686-25444708 CTTTTCAATAAGATCTTCCCTGG - Intergenic
1124410735 15:29434308-29434330 CCTTTCAAAAAGATGTTCCCTGG + Intronic
1125835326 15:42745769-42745791 CCTTTCAAAGAGATGCAGCCTGG + Exonic
1126319422 15:47406007-47406029 CCTTTCAAAGAGCAGTTCTCAGG - Intronic
1126519374 15:49574035-49574057 GATTTCAAAGCAATGTTGCCAGG - Intronic
1126912830 15:53433306-53433328 CATTTGAATGAGATTTTACCTGG + Intergenic
1128323368 15:66707461-66707483 CATTTCAAAGGGATAATGCCAGG - Intronic
1128331545 15:66759208-66759230 TATTTCAAAGACATGTTGTCAGG - Intronic
1130397447 15:83515271-83515293 CATTTCAAAGAATTGTCCTCTGG + Intronic
1131908724 15:97172533-97172555 CTTTTTAAAGAGACATTCCCAGG + Intergenic
1134517286 16:14897329-14897351 CATTTAAAAGGGATGTTTCTGGG - Intronic
1134704954 16:16295983-16296005 CATTTAAAAGGGATGTTTCTGGG - Intergenic
1134962587 16:18416131-18416153 CATTTAAAAGGGATGTTTCTGGG + Intergenic
1134966884 16:18498730-18498752 CATTTAAAAGGGATGTTTCTGGG + Intronic
1135506008 16:23036968-23036990 CATCTCCAAAAGCTGTTCCCTGG - Intergenic
1135849832 16:25953242-25953264 CATTTCACAAAGATCTTCCCTGG - Intronic
1136062390 16:27735505-27735527 CTTCTCAAATAGCTGTTCCCCGG + Intronic
1138264271 16:55648792-55648814 CATTTCAAAGATTAGTACCCAGG + Intergenic
1138811210 16:60152883-60152905 AATTTCAAAGTCATGTGCCCTGG - Intergenic
1138855180 16:60682089-60682111 GATTTAAAAGAAATGTTTCCAGG - Intergenic
1140799198 16:78469734-78469756 CATTTTATAGAAATGTTACCAGG + Intronic
1142727548 17:1827633-1827655 CATCAAAAAGAGATGTTACCAGG + Intronic
1143443443 17:6993363-6993385 CATTTCAAGGAGATGGCTCCTGG - Intronic
1143939449 17:10524729-10524751 TATGTCCAAGAGATGGTCCCAGG - Intronic
1143964127 17:10744311-10744333 CATTTCAAAGAAATGCACGCAGG - Intergenic
1146622014 17:34406055-34406077 GGTTTCTAAGAGATGTTCTCAGG - Intergenic
1152363151 17:79841618-79841640 CATTGCAAACAGATTTTCCAGGG - Intergenic
1153848712 18:9072855-9072877 CATTTCAAATAGATCTGGCCGGG + Intergenic
1155915486 18:31553164-31553186 CATTTCAAAAAGATAGCCCCAGG + Intergenic
1158325632 18:56311403-56311425 CATCAGAATGAGATGTTCCCAGG - Intergenic
1158974633 18:62700400-62700422 CATTTCAAAGAGGTGGCTCCTGG + Intergenic
1159502582 18:69293231-69293253 CATTTCAAAAAGATGGCTCCCGG + Intergenic
1162228228 19:9242549-9242571 CATGTCAAAGAAATGTTTTCAGG - Intergenic
1163918023 19:20259913-20259935 CATTTCACTAAGATGTTCACAGG - Intergenic
925829417 2:7879426-7879448 CATTTCAAAGATCTGTGCCCTGG + Intergenic
926485318 2:13448109-13448131 AAATTCATAGAGAAGTTCCCAGG - Intergenic
927077275 2:19591217-19591239 TATTTCCAGGAAATGTTCCCAGG + Intergenic
927136609 2:20101311-20101333 CCTTTCAGAGAGACTTTCCCTGG + Intergenic
927192820 2:20528512-20528534 CTTTTTAAAGAGGTGTTCCATGG - Intergenic
927438987 2:23096613-23096635 CATTTCAAAGAGCTCATCTCAGG - Intergenic
930229894 2:48832761-48832783 CATATCTAAGAGAGGTTCCATGG - Intergenic
930458075 2:51632126-51632148 CATTTCAAAGAATGGCTCCCTGG + Intergenic
930907139 2:56584431-56584453 CATTTTGAAGAGATGTTCTTGGG + Intergenic
931096313 2:58944524-58944546 CATTTGAAAAATATGTTCCCTGG + Intergenic
934944771 2:98532126-98532148 CATGACAAAGATATCTTCCCAGG + Intronic
935244282 2:101204859-101204881 CATTGAAAAGAGAGGCTCCCCGG + Intronic
937786051 2:125899867-125899889 GATATCAAACAGATGTTTCCAGG + Intergenic
938703555 2:133900264-133900286 CACTTCAGAGAGACCTTCCCAGG + Intergenic
940490337 2:154351211-154351233 CATTTCCAAAAGATATTCCATGG - Intronic
940646624 2:156398943-156398965 CATTTAAAAGGGATCTTCTCTGG + Intergenic
941841806 2:170093227-170093249 GATTTCAGTGAGATTTTCCCAGG - Intergenic
943886249 2:193220104-193220126 CATTTCAAATTGAACTTCCCTGG - Intergenic
943917830 2:193660468-193660490 TATTTCAAAGGGATGTTTTCAGG - Intergenic
945062166 2:205918857-205918879 CCTTCCAAAGAGAGGTCCCCTGG - Intergenic
945772052 2:214056002-214056024 CAGTTCAATGATATGATCCCTGG + Intronic
946852460 2:223920352-223920374 TATAGCAAAGGGATGTTCCCTGG + Intronic
947018242 2:225645335-225645357 CAATACAATGAGATGTTTCCAGG - Intronic
947921350 2:233877462-233877484 CATCTCAAAGAGAAGAGCCCAGG - Intergenic
1168779743 20:478544-478566 CATTTCTTAGAGAAGTTCCTGGG - Intronic
1169971806 20:11276808-11276830 AATGTCAAAGAGCTTTTCCCAGG - Intergenic
1170061762 20:12266315-12266337 GATTTCAATGAGATTGTCCCTGG + Intergenic
1172663802 20:36585584-36585606 CAATCAAAAGAGATGTCCCCAGG - Intronic
1173109806 20:40176095-40176117 CCTTTTAAAGAGAGGTTGCCAGG + Intergenic
1175572313 20:60033279-60033301 TATTACAAAGACAAGTTCCCGGG - Intronic
1182246163 22:28959391-28959413 TATTTGAAAGAGGTCTTCCCAGG - Intronic
1183076277 22:35429279-35429301 CATTTCAAAAAGATTTGGCCGGG - Intergenic
1183452061 22:37901953-37901975 CATCTCAAAGAGGTGTTCCCTGG + Intergenic
950152163 3:10696259-10696281 GATTTCATAGACATGTTCTCCGG + Intronic
956971134 3:74527488-74527510 CAACTCAAAGAGATCTTCTCTGG + Intergenic
958694279 3:97508096-97508118 CATTTCAAAAAACTGTCCCCTGG + Intronic
958842170 3:99219636-99219658 CATTTCAAAGATATTTTCTCTGG - Intergenic
959200936 3:103246005-103246027 CCTTTCACAGAGATGTTACTGGG + Intergenic
959562795 3:107801696-107801718 CATTTCACAGAGATGTTATGTGG + Intronic
962017071 3:131452808-131452830 TAGTTTAAAGAGATGTTCCCAGG + Intergenic
962891804 3:139678630-139678652 CATTCCAAATAAATGTTCACTGG - Intergenic
962967092 3:140365368-140365390 CATTTCAAAGGGATTTTTCAAGG + Intronic
963256283 3:143147856-143147878 CATTTCTAAGAGAAGCTCCATGG - Intergenic
964316338 3:155448463-155448485 TCCTTCAAATAGATGTTCCCAGG + Intronic
964418967 3:156481042-156481064 TATTTCAAGGAGATGTTGACAGG + Intronic
965692226 3:171370059-171370081 TATTTCAAAGAGAAATACCCTGG - Intronic
969935358 4:10674635-10674657 CATGTCAAAGAGAGGTGCACAGG + Intronic
970802756 4:19994405-19994427 CATTGCAAAGAGGTAGTCCCTGG + Intergenic
971996375 4:33970825-33970847 CACTTCAGAGAGATGGTTCCAGG - Intergenic
972132707 4:35858421-35858443 TATTTCAAACAGATGGTTCCAGG + Intergenic
975231557 4:71940340-71940362 AATTTCATTGAGATGTGCCCAGG - Intergenic
977176539 4:93827260-93827282 CATTGCAAAGACATATTCCAGGG + Intergenic
977870352 4:102083184-102083206 CCTCTTAAAGAGATCTTCCCTGG - Intergenic
979388358 4:120097499-120097521 GACTTCAAAGAGATTTTCCCTGG - Intergenic
979719460 4:123882109-123882131 CACTTTAAAGAGATCTTCTCTGG + Intergenic
983294659 4:165850839-165850861 CATTTCAAAGAGATAATACTGGG - Intergenic
984426897 4:179598703-179598725 CAATTTAAAGAAAGGTTCCCTGG - Intergenic
984849481 4:184141567-184141589 CATTTCCCTGCGATGTTCCCTGG - Intronic
986968262 5:13301611-13301633 CATTGCAAGGAGAGGTTCCTAGG + Intergenic
987770392 5:22294910-22294932 CATTTCATAGGGATTCTCCCAGG - Intronic
987841693 5:23230956-23230978 CATTGCAAAGATATGGTCCCAGG - Intergenic
988304085 5:29471614-29471636 TATTTTAAAGAGATGGTTCCTGG + Intergenic
988917071 5:35905226-35905248 TATTTCAAAGAGATGGTCATGGG - Intronic
991634255 5:68687580-68687602 CATTCCAAAGAAAGGTACCCTGG - Intergenic
993664670 5:90681223-90681245 CTTTTCAAAAAGTTGTTCCTTGG + Intronic
994362057 5:98862803-98862825 TATTTAAAAGAGAAGTTGCCAGG + Intronic
996261690 5:121478847-121478869 CATTTCAAAGAGATGGCTGCCGG - Intergenic
996878441 5:128265931-128265953 CATTTCAGACAGATTTCCCCCGG - Intronic
997754350 5:136382163-136382185 CATTTCAAAGAGATGGCTTCCGG + Intronic
998384730 5:141750252-141750274 CATTTCAGAGACTTGCTCCCTGG + Intergenic
1000177959 5:158776831-158776853 CATTCCACAGAGATGCTGCCTGG + Intronic
1000368599 5:160513579-160513601 CATTTCAAAGAGAACTTTACAGG + Intergenic
1000962785 5:167619980-167620002 CATCCCAAAGAGATTTTCTCTGG - Intronic
1001303881 5:170557368-170557390 CATCTCAAAGAGGTGTGGCCTGG + Intronic
1001329658 5:170753309-170753331 CATTTCAATGTGATGATCTCAGG - Intergenic
1003934816 6:10964520-10964542 AATGTCAAAGAAATGTTCACTGG - Intronic
1005117285 6:22352802-22352824 CATTTGAAATAGATGTCCACAGG - Intergenic
1007883876 6:45203545-45203567 CATTTCAAACAGATCATCCTGGG - Intronic
1008592298 6:53006464-53006486 TATTACAAAGACATGTACCCAGG + Intronic
1008832350 6:55780933-55780955 CATTTCAGAGTGATGTCCCATGG - Intronic
1010102707 6:72128164-72128186 CATTTCAAACAGATGGCTCCAGG + Intronic
1010284785 6:74063554-74063576 CATTTCAGAGAGATGAGCCCAGG - Intergenic
1010661820 6:78580346-78580368 CATTTCAAGGAGATGATCTCAGG + Intergenic
1013770046 6:113618290-113618312 CTTTTCAGAAAGATCTTCCCTGG + Intergenic
1014348971 6:120314986-120315008 AATTTCAAAGAGATACTCCCGGG + Intergenic
1014874150 6:126635341-126635363 TATTTAGAAGAGATGTTTCCAGG + Intergenic
1015984597 6:138872545-138872567 AATTTCAAAGAGATGGTGGCTGG - Intronic
1017238466 6:152141388-152141410 AATTACAAAGAGATTTTCCCCGG - Intronic
1017254307 6:152315545-152315567 TTTTTCAAAGAGATTTTACCAGG + Intronic
1017363466 6:153604312-153604334 GATTTCAAAGAGAGGTTACTGGG - Intergenic
1018623571 6:165755395-165755417 CATTTCAAAGACATTTCCCCAGG - Intronic
1019876858 7:3820541-3820563 CATTTCAAATAAAAGTTCCTTGG + Intronic
1020561514 7:9733188-9733210 TATTTCAAAGAGATGGTCTATGG - Intergenic
1021326782 7:19280474-19280496 CATTTCAAAAAGATTTTTCTTGG + Intergenic
1022798365 7:33751260-33751282 CATTTCGAAGATACGTGCCCAGG - Intergenic
1023126210 7:36956962-36956984 CATTTCCAAGTTATGTTCCATGG + Intronic
1024640757 7:51326847-51326869 CATTTGACAGATCTGTTCCCTGG - Intergenic
1025070571 7:55894263-55894285 CATTTCAAGGAAAGGTACCCTGG - Intronic
1027526640 7:79277834-79277856 CGTTTCAAAGAGATGACTCCAGG - Intronic
1028266341 7:88731465-88731487 CATTTCAAGGATATTTTTCCTGG + Intergenic
1031299483 7:120046535-120046557 CATTTCAAAGAGTGGTTCTCAGG - Intergenic
1031839589 7:126721528-126721550 TACTTCAAAGATATTTTCCCAGG + Intronic
1032332879 7:130996400-130996422 CTTTTCCAGGAAATGTTCCCTGG + Intergenic
1034385139 7:150734688-150734710 CATTTCAAACAGAAGGTCCAAGG + Intronic
1035205923 7:157293723-157293745 CATTTCCAAGAGGTTTTCCTTGG - Intergenic
1035208539 7:157310819-157310841 CATTTCCAAGAGGTTTTCCTTGG + Intergenic
1037094820 8:14973221-14973243 CATTTCAAAGGGATGGCTCCTGG - Intronic
1037580990 8:20245954-20245976 CATTTCACAGATAAGGTCCCGGG + Intergenic
1037647782 8:20809348-20809370 CATTTGAAAGAGATATTTACAGG + Intergenic
1038911325 8:31967905-31967927 TTTTTCATAGAGATGTTCTCTGG - Intronic
1041523446 8:58779377-58779399 CATTTCAAAAAGAAGTGTCCTGG - Intergenic
1043506107 8:80904649-80904671 CATTTCAGCAAGATCTTCCCAGG - Intergenic
1043590280 8:81823921-81823943 CAGTTAAAAGAGATGTTTCCAGG - Exonic
1043718594 8:83514673-83514695 CATTTCAAAGAAATGGTTCCTGG - Intergenic
1045430587 8:102111191-102111213 CATTTAAAGAATATGTTCCCTGG - Intronic
1045650375 8:104336703-104336725 CATTTCAGAGTGATGTTCCCAGG - Intronic
1048538834 8:135323951-135323973 CATTTCACAGAGAGGTGCCAGGG - Intergenic
1049935399 9:497118-497140 CCTTTCAAACAGTTGTTTCCAGG + Intronic
1050326916 9:4506867-4506889 CATGGAAAACAGATGTTCCCTGG - Intronic
1050865386 9:10490797-10490819 AATTTCAAATAAATGTTCCCTGG - Intronic
1051516757 9:17938396-17938418 AATTTCAAAGAGATACCCCCAGG + Intergenic
1051835598 9:21334612-21334634 TATTTCAAAGCCATGTTCACAGG - Exonic
1055648101 9:78379747-78379769 CATTTCAAAGAGATGGTTCCTGG + Intergenic
1055874434 9:80925027-80925049 CATTTCCCAGAGATGTTCTGGGG + Intergenic
1056261847 9:84856615-84856637 CATTTGAAAGAGGAGTCCCCGGG - Intronic
1056262526 9:84862996-84863018 CATTTGAAAGGCATGCTCCCAGG + Intronic
1057355876 9:94331040-94331062 CATTTCATAGAAATGCTCGCTGG - Intergenic
1057651880 9:96926589-96926611 CATTTCATAGAAATGCTCGCTGG + Intronic
1058871835 9:109208647-109208669 CAGTTCAAATAGGTGGTCCCAGG - Intronic
1059728865 9:117036493-117036515 CATATGAAAGGGATGCTCCCTGG - Intronic
1187467595 X:19540816-19540838 CATCTCAAAGAGTTATTTCCCGG - Intronic
1187926451 X:24255000-24255022 AAGTTCAAAGATATTTTCCCTGG + Intergenic
1188951602 X:36382218-36382240 CATTTCCCAGAGATCTTCCACGG - Intronic
1189672572 X:43426539-43426561 CATTTGGAAGAGGTGTTCTCAGG - Intergenic
1190659162 X:52638952-52638974 CATTTCAAAGAGATGGCTCAAGG + Intergenic
1190677557 X:52795182-52795204 CCTTTCAAAGAGATGCTCCATGG + Intergenic
1191136226 X:57068036-57068058 CATTTGCATGAGAAGTTCCCTGG - Intergenic
1192255854 X:69458091-69458113 CATATGAAAGACATGCTCCCTGG + Intergenic
1192894508 X:75427186-75427208 CAGTTCAGAGAAATGCTCCCTGG - Intronic
1193110508 X:77724850-77724872 CATATCATAGAGATGATCCCTGG + Intronic
1194869872 X:99116434-99116456 CATTTCAAAGAGATATTCAAAGG + Intergenic
1194998004 X:100612807-100612829 TATTTCAAAGTGAAATTCCCTGG - Intergenic
1197120993 X:122892112-122892134 AATTTCACAAAGATGTTGCCTGG - Intergenic
1197526474 X:127570510-127570532 CATTTGAAAGGTGTGTTCCCAGG + Intergenic
1197640049 X:128957859-128957881 CATTTCTAAGATATATTCTCAGG + Intergenic
1198092186 X:133342377-133342399 CATCTCAGAGAGATCTTTCCGGG + Intronic
1198484140 X:137069641-137069663 CATTTCACAGATATGATACCGGG - Intergenic
1200051400 X:153433667-153433689 CATTTCAAAGAGATGTGTCCGGG - Intergenic