ID: 1109748832

View in Genome Browser
Species Human (GRCh38)
Location 13:66663286-66663308
Sequence CAATAAATATTAATGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 443}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109748832_1109748837 29 Left 1109748832 13:66663286-66663308 CCTTTCACCATTAATATTTATTG 0: 1
1: 0
2: 2
3: 47
4: 443
Right 1109748837 13:66663338-66663360 AATATGAAGGCAAAAAAACCTGG 0: 1
1: 0
2: 1
3: 43
4: 516
1109748832_1109748835 16 Left 1109748832 13:66663286-66663308 CCTTTCACCATTAATATTTATTG 0: 1
1: 0
2: 2
3: 47
4: 443
Right 1109748835 13:66663325-66663347 CAGGATTCTTCCAAATATGAAGG 0: 1
1: 0
2: 2
3: 30
4: 277
1109748832_1109748838 30 Left 1109748832 13:66663286-66663308 CCTTTCACCATTAATATTTATTG 0: 1
1: 0
2: 2
3: 47
4: 443
Right 1109748838 13:66663339-66663361 ATATGAAGGCAAAAAAACCTGGG 0: 1
1: 0
2: 0
3: 37
4: 382
1109748832_1109748834 -3 Left 1109748832 13:66663286-66663308 CCTTTCACCATTAATATTTATTG 0: 1
1: 0
2: 2
3: 47
4: 443
Right 1109748834 13:66663306-66663328 TTGTGTAGCTTAAATGCAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109748832 Original CRISPR CAATAAATATTAATGGTGAA AGG (reversed) Intronic
900729348 1:4243543-4243565 CAAAAAATATTATTGAGGAAAGG - Intergenic
901789850 1:11648389-11648411 CAATAAATATTATTTGTCCAAGG - Exonic
904551049 1:31318401-31318423 CAATAAATGTTAGTGATGAAAGG - Intronic
905154789 1:35967384-35967406 AAATAAATATTAATGGGGCATGG - Intronic
905346494 1:37314568-37314590 CAATACATATTACTGATGGATGG + Intergenic
907171333 1:52468401-52468423 CCATAAATGTTACTGGGGAAGGG + Intronic
908035491 1:60046777-60046799 CAAGAAAAAATAATGATGAAAGG - Intronic
909523787 1:76599795-76599817 CAATAAATTGTGATGGAGAATGG - Intronic
910818130 1:91314104-91314126 AAATACATATTAATCTTGAAGGG + Intronic
913377269 1:118166234-118166256 CAAAGAATAATGATGGTGAAGGG + Intronic
913541779 1:119828036-119828058 GAATCAAAATTGATGGTGAAGGG - Intergenic
913957160 1:143317395-143317417 AAATAAATATTAATTTGGAAAGG + Intergenic
914051474 1:144142759-144142781 AAATAAATATTAATTTGGAAAGG + Intergenic
914127723 1:144823782-144823804 AAATAAATATTAATTTGGAAAGG - Intergenic
916122717 1:161543029-161543051 CCATAAATTTAAATGGAGAAAGG - Exonic
916140250 1:161690757-161690779 CAATACATACTAATGGTAGAAGG - Intergenic
916229695 1:162528911-162528933 CAATAAATTTTAATGGTTGATGG + Exonic
916298800 1:163250350-163250372 CAAGATATATTGATGGTTAAAGG - Intronic
916315085 1:163439851-163439873 CAGTAAATATTCATAATGAATGG + Intergenic
916700186 1:167284849-167284871 CAACAAACATTTATTGTGAAAGG - Intronic
916921902 1:169477783-169477805 CAAAAAACATTAGTGATGAAAGG + Intronic
917001333 1:170364066-170364088 ACATAAATATTAAAGGTCAATGG - Intergenic
918227509 1:182498075-182498097 CAATACTTATTAATCATGAAAGG - Intronic
918519571 1:185400828-185400850 AAATAAATATAAAAGGTGAAAGG + Intergenic
918539048 1:185607177-185607199 CATTAAATATGAATTTTGAAGGG + Intergenic
919458838 1:197852192-197852214 CAATAAATATTAATGGTTCCAGG + Intergenic
919485859 1:198146391-198146413 CAATAAATATTAATTAGTAATGG + Intergenic
919542456 1:198867081-198867103 CATTAAATATAAATGGTTACCGG + Intergenic
919701339 1:200634426-200634448 CTATGAATATAAATGGTGAGGGG + Intronic
920581619 1:207113864-207113886 CAATAAACAATAATGATAAAAGG - Intronic
920633160 1:207672162-207672184 CAATATATATTAAAAGTAAATGG + Intronic
921182943 1:212645779-212645801 CAATAAACACCAAGGGTGAATGG + Intergenic
921648243 1:217645560-217645582 TGTTAAATATTAATGGTAAAAGG + Intronic
921782731 1:219186311-219186333 CTATAAATGTTAATGGTTCAAGG + Intronic
922415689 1:225420624-225420646 CACTAAATATTAAAAATGAAAGG + Intronic
922585069 1:226727817-226727839 TAATACGTATTAATGATGAAGGG - Intronic
923956708 1:239030796-239030818 CATTAAATGTTAATGGACAATGG + Intergenic
924017472 1:239743235-239743257 CAATAAAAAGTAATGATGAATGG - Intronic
1063535860 10:6882781-6882803 CCATAGATTTCAATGGTGAAGGG - Intergenic
1064818855 10:19300590-19300612 CAATAAAAAGCAATGGGGAAAGG + Intronic
1065182379 10:23139610-23139632 CAATAAATATTGATGATGGGAGG + Intergenic
1065223123 10:23516332-23516354 CCATAGATATTAATGATGACTGG - Intergenic
1066074688 10:31861530-31861552 CAATTCAGATTAATGGAGAATGG - Exonic
1066648674 10:37635601-37635623 AAATAAATATAATTGTTGAAAGG + Intergenic
1067031556 10:42881291-42881313 AAATAAATATAATTGTTGAAAGG + Intergenic
1068134892 10:52941588-52941610 CAAAAAAATTTAATGGAGAAAGG - Intergenic
1068353988 10:55886618-55886640 CAATAACAAGTAATGGGGAAAGG + Intergenic
1069428959 10:68315984-68316006 CAATAACAAACAATGGTGAAGGG + Intronic
1071162758 10:82770204-82770226 CAATAAATTATAAAAGTGAAAGG + Intronic
1071271537 10:84011919-84011941 TATAAAATATTAATGGAGAAAGG - Intergenic
1072754551 10:98010349-98010371 TAATAATTATCAATGGTGATTGG + Intronic
1072850959 10:98891603-98891625 AAATAAAAATTAGTGGTGCATGG - Intronic
1073679723 10:105689546-105689568 CAATAAATATTGATGATGGGAGG + Intergenic
1074623503 10:115151973-115151995 CAAAAACAATTAATGGGGAAAGG - Intronic
1074646680 10:115461120-115461142 TAATAATTTTTAATGGTTAAGGG + Intronic
1075697212 10:124445952-124445974 CAATCAAATTTAATGGTCAATGG - Intergenic
1075834458 10:125441956-125441978 CAATAAAAGTGAAGGGTGAAAGG - Intergenic
1075896840 10:126003648-126003670 AAATAAAAGTTAATGGGGAATGG - Intronic
1076663684 10:132072597-132072619 CACTAAATATTAAATGTAAATGG - Intergenic
1077587404 11:3464169-3464191 CTATAAAGATTACTGGTGGAGGG - Intergenic
1079737620 11:24016347-24016369 GAATAAATATTAATTTTGAAAGG + Intergenic
1079955265 11:26854843-26854865 CAATAAATGTTAATAGTGCTGGG + Intergenic
1080039947 11:27748954-27748976 TGATCAATATTAATGTTGAAGGG - Intergenic
1080330113 11:31127067-31127089 CAATAGAAATTGAAGGTGAAAGG - Intronic
1080344095 11:31302553-31302575 TCATAAATATTAATTGTGTATGG - Intronic
1081342937 11:41949918-41949940 CAATAAATTAAAATTGTGAATGG - Intergenic
1082655472 11:55851123-55851145 AATTAAATATTAATGCTAAATGG - Intergenic
1083199718 11:61113130-61113152 CTTTATATATTAATAGTGAAAGG - Intronic
1084829587 11:71758771-71758793 CTATAAAGATTACTGGTGGAGGG + Intergenic
1086563906 11:88202296-88202318 CAATAAATAGTATTGGAGCAGGG - Intergenic
1086752978 11:90522058-90522080 CAATAAATCTAAAATGTGAATGG + Intergenic
1087485699 11:98757725-98757747 AAACAAATATTACTGGAGAATGG - Intergenic
1088437658 11:109833334-109833356 AAATAAAAATTAAAGTTGAAAGG - Intergenic
1089886967 11:121835437-121835459 AAATAAATAGTAAAGGTGAGAGG + Intergenic
1092413651 12:8272921-8272943 CTATAAAGATTACTGGTGGAGGG - Intergenic
1092551370 12:9504739-9504761 TAATAAAAATAAATGATGAAAGG - Intergenic
1093783308 12:23162487-23162509 TAATAAAAATTAATGATGAAAGG - Intergenic
1094104521 12:26796576-26796598 CTAGAAATAGAAATGGTGAATGG - Intronic
1095195812 12:39315300-39315322 CATAAAATGATAATGGTGAAAGG + Intronic
1095330968 12:40963396-40963418 CAAATAATATTGTTGGTGAAAGG + Intronic
1095555479 12:43498884-43498906 GCAAAAATATTAAAGGTGAAAGG - Intronic
1096128614 12:49139100-49139122 AAATAAATATTAATGAATAAAGG + Intergenic
1096548030 12:52354670-52354692 GATTAAATATCAATGGCGAAAGG + Intergenic
1096867090 12:54571063-54571085 CAGTAGATGTTAAAGGTGAAGGG + Intronic
1098976246 12:76905061-76905083 CCATACATATTAAAGGTGTAAGG + Intergenic
1099084783 12:78232124-78232146 AATTAAATGTTAATGGTAAAGGG - Intergenic
1099593736 12:84629574-84629596 CAATCAATATAAATGGAGGAGGG + Intergenic
1099991850 12:89731123-89731145 CAATACCCATTAATGGTGATTGG + Intergenic
1100169862 12:91962157-91962179 CAATAAATATTTATTGTTCATGG - Intergenic
1100176066 12:92032250-92032272 CAAAAAATAATAATAATGAAAGG + Intronic
1101166535 12:102040628-102040650 CAATAAAGAATACTGGGGAATGG + Intronic
1101331558 12:103761617-103761639 CAACAGATATTAATGGTGACTGG - Intronic
1102429171 12:112868266-112868288 GAATAAATATGAATTGTGCAGGG + Intronic
1103699162 12:122839549-122839571 CAATAAATGTTAATCTTGACAGG - Intronic
1104153504 12:126107894-126107916 CAATAAAGATTAATTGACAAAGG + Intergenic
1104428474 12:128697145-128697167 GAAGAAATATTACTGGTAAAGGG + Intronic
1104430478 12:128711941-128711963 CTATTAATATTAATAGAGAAGGG - Intergenic
1107771890 13:43795858-43795880 GAATAAATATTAATATTTAATGG + Intergenic
1108294993 13:49006923-49006945 TAATAAATGTTAATGAGGAAGGG + Intronic
1108341187 13:49499747-49499769 CAATAAACACTAATGATAAAAGG + Intronic
1108895650 13:55324448-55324470 CAATAAATATTAATGTCTAAAGG - Intergenic
1109748832 13:66663286-66663308 CAATAAATATTAATGGTGAAAGG - Intronic
1109805595 13:67437592-67437614 CAATAAATATTAAAAATAAAAGG - Intergenic
1109896970 13:68705461-68705483 AAAAAAATATTTATGGTGAAAGG + Intergenic
1110147510 13:72209575-72209597 TAATAAACATTAATAATGAAGGG - Intergenic
1111757121 13:92412575-92412597 CAATAAAAATTTATGGAGACAGG - Intronic
1112212306 13:97390123-97390145 CATTAAATATTTATAGTAAATGG - Intronic
1112749733 13:102569902-102569924 CCATAAATGTTTATGGTTAATGG - Intergenic
1114708494 14:24752324-24752346 CAATTAATAATAGTGGTGCAGGG - Intergenic
1114952862 14:27778945-27778967 CAATAAATTTTATTTGTTAAAGG - Intergenic
1115684667 14:35783730-35783752 CAAAAATTTTTAATGGTCAAAGG + Intronic
1116537756 14:46056736-46056758 CATTATTTCTTAATGGTGAAGGG + Intergenic
1116937931 14:50761237-50761259 CATTAAATATAAATCCTGAAGGG + Intronic
1116947629 14:50850617-50850639 AAATAAATATTAATTCTGACTGG + Intergenic
1117885765 14:60361242-60361264 CAATAAATATTTCTGAGGAAAGG - Intergenic
1118201280 14:63676236-63676258 TATTAAATTTTAATAGTGAAAGG + Intergenic
1119809354 14:77503391-77503413 CAAAAAACCATAATGGTGAATGG - Intergenic
1119857247 14:77909789-77909811 CAATAAATGCTAATGGTAAAAGG - Intronic
1122320146 14:100850733-100850755 CAATAAATAGGACTTGTGAATGG + Intergenic
1122625037 14:103080594-103080616 CAATAAGTATTAATAGTAGATGG + Intergenic
1124145811 15:27124223-27124245 CAATAAATATAACTTGTGGAAGG + Intronic
1124815063 15:32981908-32981930 CAGAAAATTTTAATTGTGAAAGG - Intronic
1126205841 15:46043738-46043760 TAATAATCAATAATGGTGAATGG - Intergenic
1126357304 15:47810397-47810419 CAATAAATATTTATTATGCATGG + Intergenic
1126474171 15:49048845-49048867 CAATAAATATTTAATGTGCAAGG + Intergenic
1126660220 15:51025860-51025882 AAAAAAAGATTAATGATGAAAGG - Intergenic
1126799104 15:52284063-52284085 CAATAAATATTAATCTTTAAAGG + Intronic
1126948708 15:53854554-53854576 CAAAAACAATTAATGGGGAAAGG - Intergenic
1128905315 15:71462631-71462653 GAATAAAAATTAAGGGTCAATGG - Intronic
1129419273 15:75410607-75410629 CAATAAATATTAATGCCCAGGGG + Intronic
1129962817 15:79703511-79703533 CAACAAATATTAATTGTGCCAGG + Intergenic
1130019306 15:80214134-80214156 CAATAAAAATTAGTGGGAAAAGG + Intergenic
1131339891 15:91588977-91588999 CAATTTATATCAAAGGTGAAAGG + Intergenic
1131814017 15:96203679-96203701 TTATAAACATAAATGGTGAAAGG + Intergenic
1132126290 15:99228088-99228110 CAATAGATATTTATGATGACTGG + Intronic
1132966253 16:2656692-2656714 GAATAAAAATTAGTGGAGAAAGG + Intergenic
1133521367 16:6560870-6560892 CAATAAATATTTAATGTGAAAGG + Intronic
1133687015 16:8175180-8175202 CAATTCATATTAATGTTTAAAGG + Intergenic
1133842824 16:9425435-9425457 CTATACATTTTAAGGGTGAATGG + Intergenic
1133922302 16:10164187-10164209 CAGTAAATATTAATTGACAAAGG - Intronic
1134260218 16:12645148-12645170 CAATAAACAAGAATGGTGAGAGG - Intergenic
1134430277 16:14197804-14197826 AAATCATTATTAATGGTTAATGG + Intronic
1134907997 16:17998376-17998398 CAATAAAAATATATGCTGAAGGG + Intergenic
1135255011 16:20934185-20934207 TAAAAAATTTTTATGGTGAATGG + Intronic
1136611731 16:31370623-31370645 CAATGAGTATTAAGGCTGAAAGG - Intronic
1137351225 16:47715505-47715527 CAATAAATATCTATTATGAATGG + Intergenic
1137412171 16:48238101-48238123 CAAAAAATATTTTTAGTGAATGG + Intronic
1137435992 16:48454634-48454656 AAATAAATATTGGTGATGAATGG - Intergenic
1137465201 16:48701813-48701835 CAAAAATTATCAATGGGGAAAGG - Intergenic
1137533176 16:49296501-49296523 CAATAACTATCAGTGGTGATGGG - Intergenic
1137546597 16:49408897-49408919 CAATAAATGTTAGTGCTTAAAGG - Intergenic
1138826695 16:60329539-60329561 CAAAAATTAAGAATGGTGAAAGG + Intergenic
1139072312 16:63397876-63397898 CAGTAAATATTAATGATGGGAGG - Intergenic
1139086593 16:63594251-63594273 CAATACAAATTCATGTTGAAAGG + Intergenic
1139218925 16:65158807-65158829 CAATAAGGATAAATGGTGAGGGG + Intergenic
1139497853 16:67334317-67334339 AAATAAAAAATAATGGTGGACGG - Intronic
1140770403 16:78198477-78198499 CAATAAATACTGATGGAGAATGG + Intronic
1142974059 17:3632797-3632819 AAATAAATATAAACTGTGAAAGG + Intronic
1144087444 17:11823453-11823475 CAAAAGAAATGAATGGTGAAAGG + Intronic
1147017457 17:37503685-37503707 CAATAACTATAAAAGGTGGAAGG - Intronic
1147563631 17:41523619-41523641 CAATAAAAATTTATGGTCCAAGG - Exonic
1147798130 17:43060487-43060509 CAAGAAATAATAATGATAAAAGG - Intronic
1149408450 17:56378988-56379010 CAATATACATTATTGGAGAAAGG - Intronic
1150302821 17:64060315-64060337 CAAAAAACATAAATGGTTAAGGG - Intronic
1150548507 17:66187722-66187744 AAATAAAATTTAAGGGTGAATGG - Intronic
1150771906 17:68049548-68049570 AAATTAAAATTAATGGTCAAAGG + Intergenic
1151861108 17:76762712-76762734 CAGTAAATATTAATTGACAAAGG + Intronic
1152489865 17:80623505-80623527 CGATAAATATTTAAGGTGATAGG - Intronic
1154180281 18:12131339-12131361 AAATAAATATAAATAGTGAATGG + Intergenic
1155627844 18:27856927-27856949 CAAAAACAAGTAATGGTGAAAGG - Intergenic
1156137812 18:34065274-34065296 TAATAAATATTAAGTGTCAAAGG - Intronic
1156221885 18:35060993-35061015 AAATAATCATTAATGGTAAAAGG + Intronic
1157013735 18:43683266-43683288 CAAAATATGTTAATGGTGGAGGG + Intergenic
1158096043 18:53772433-53772455 CAATAAATATTTGTTGTGAATGG - Intergenic
1158711117 18:59839064-59839086 CAAGACATCTTAATGGAGAAAGG - Intergenic
1159160742 18:64641160-64641182 GAATAAATGTTAGTGATGAATGG - Intergenic
1159189901 18:65027913-65027935 CTATGAATATTAATGAAGAAGGG - Intergenic
1159329209 18:66967609-66967631 CAATAAATATAGGTTGTGAAAGG + Intergenic
1159533585 18:69686540-69686562 CAATAAATATTAAATCTGAGGGG + Intronic
1159994357 18:74949185-74949207 AAATAAATATTTATAATGAATGG + Intronic
1163462241 19:17446002-17446024 CAATGAATATGAATGGTAAATGG - Intronic
1164143755 19:22497005-22497027 AAATAAATATCTATGGTTAAAGG - Intronic
1164495432 19:28756412-28756434 CAATAAATTTTGAATGTGAATGG + Intergenic
1164729614 19:30493245-30493267 CAATAAATATGGCTGGTGACTGG - Intronic
1164792012 19:30995260-30995282 TAATCAATATTAATGGTGAAAGG - Intergenic
1165661955 19:37588814-37588836 CAGTAAATGTTATTGGAGAAAGG + Intronic
926487012 2:13474469-13474491 CCTAAAATATTAATGTTGAATGG + Intergenic
926563520 2:14444390-14444412 CACTCAATATTAATGATCAAGGG - Intergenic
926902545 2:17769803-17769825 AAATTAATATTAATGATGATAGG + Intronic
928276961 2:29910823-29910845 CATTAAATATTAAAGGCTAAAGG + Intronic
929276364 2:40029627-40029649 ACATAAAGATCAATGGTGAATGG - Intergenic
930170182 2:48243794-48243816 AAATAAATATTAAAAATGAAGGG + Intergenic
930974140 2:57433943-57433965 GAAAAAATGTTAAAGGTGAAAGG - Intergenic
930988638 2:57622545-57622567 CAACAAAAAATAATTGTGAAAGG - Intergenic
932924847 2:75960997-75961019 CCATGAATATTGATGGTGACAGG - Intergenic
933885273 2:86713837-86713859 GAATATATATTAATGTTGCAAGG - Intronic
933924901 2:87082846-87082868 GAATATATATTAATGTTGCAAGG + Intergenic
934484403 2:94690034-94690056 CAATAAATTTTATTTGTTAAAGG + Intergenic
934584744 2:95481381-95481403 AAATAAATATAAATTCTGAAGGG - Intergenic
934594713 2:95595335-95595357 AAATAAATATAAATTCTGAAGGG + Intronic
934788064 2:97030299-97030321 AAATAAATATAAATTCTGAAGGG - Intergenic
935813401 2:106823399-106823421 CAATAAATGTTAAAGGGAAAAGG - Intronic
936688197 2:114853492-114853514 CTATAAAAATTAATAGTGCATGG - Intronic
937717516 2:125050807-125050829 AAATAAATAATAATATTGAAGGG - Intergenic
938398062 2:130964907-130964929 CCCTAAATATTAATGGAGCAAGG + Intronic
938414716 2:131094424-131094446 CAATAAAGATTAGTGATGGAAGG + Intergenic
938655853 2:133432764-133432786 TCATAACTATTCATGGTGAATGG + Intronic
938889592 2:135690806-135690828 CAAAAAATGTTAAAGGAGAAGGG + Intronic
939209770 2:139159016-139159038 CAGTATATATTAAAGGTGTAAGG + Intergenic
939811933 2:146843477-146843499 CAATAAATTTTCATGAAGAATGG - Intergenic
939918657 2:148081155-148081177 CAATAAATTTTAATGTAAAAGGG + Intronic
940483780 2:154271895-154271917 CTATAAAAATAAATGCTGAATGG + Intronic
940593035 2:155753275-155753297 CAAAAAATAGCAATGGGGAAAGG + Intergenic
940775594 2:157880159-157880181 AAATAAAGATTAATAGTGGAAGG + Intronic
941146657 2:161855370-161855392 TAATGAAAATAAATGGTGAATGG - Intronic
941223207 2:162811280-162811302 CAATAAAGATGACTGGAGAAAGG + Intronic
941530095 2:166658337-166658359 CAATAAATATTAATGTAATATGG - Intergenic
941644600 2:168026487-168026509 CAATAATGATTTATGGAGAATGG - Intronic
941692997 2:168520969-168520991 CAAATAATATTAATGTTGCAGGG - Intronic
941850407 2:170174455-170174477 AAATAAATCCTAATGGTAAAAGG - Intergenic
941858157 2:170251163-170251185 CAGTAAATGTAAATCGTGAAGGG - Intronic
941977544 2:171422286-171422308 CAAAAAATAATAATAATGAAAGG + Intronic
942850293 2:180476463-180476485 CAATAAATATTAAAAATTAATGG - Intergenic
942852324 2:180503449-180503471 CAAAAAATCTTAAAGGAGAATGG - Intergenic
943245407 2:185442960-185442982 CAAAAAATTGTAATGGTCAATGG - Intergenic
943948079 2:194093013-194093035 CAGTAAATATTAATTGACAAAGG + Intergenic
944164095 2:196699300-196699322 AAATAAATATTAATTCTGACAGG + Intronic
944212767 2:197223425-197223447 CAAAACATAATAATGTTGAATGG - Intronic
944272696 2:197801706-197801728 CAATAAATATTTATGGACAGAGG - Intergenic
945236002 2:207631864-207631886 CAATAAATATGAATGGTTCTTGG - Intergenic
945271893 2:207949033-207949055 CAATAAATATTTATGTTAAAGGG + Intronic
945626704 2:212217391-212217413 CAACAAATATTAATTGAGCAAGG + Intronic
945651962 2:212573422-212573444 AAATAAATTTTCATGGTGAGAGG + Intergenic
946388757 2:219402622-219402644 CAATAAATATTGATGGATGAAGG + Intergenic
946857581 2:223967994-223968016 CTTAAAATGTTAATGGTGAAGGG + Intergenic
947269680 2:228320036-228320058 AAATAAATATTAATTGTGCTAGG + Intergenic
1169605098 20:7308874-7308896 CAACAAATATCAATGGATAATGG + Intergenic
1169902185 20:10564780-10564802 CAGTAAAAATTAATGGTATAAGG + Intronic
1171470965 20:25370982-25371004 AATTAAAAATAAATGGTGAAGGG - Intronic
1172556509 20:35846509-35846531 TATAAAATATTAAAGGTGAATGG + Intronic
1177734787 21:25075475-25075497 CAATAATAAGCAATGGTGAAAGG + Intergenic
1178735102 21:35141942-35141964 CAACCAAAATTAATGGGGAAAGG + Intronic
1178812489 21:35896841-35896863 CATCAAACAGTAATGGTGAAAGG + Intronic
1179556191 21:42178415-42178437 CAATGTATATTAATGGTTATAGG + Intergenic
1180566351 22:16670148-16670170 AAATAAATATAAATAGTGAGTGG - Intergenic
1182727882 22:32462499-32462521 GAAGAAATATTACTTGTGAATGG + Intronic
949133854 3:538120-538142 CAATATATTTTCATGTTGAAAGG + Intergenic
949389362 3:3542121-3542143 TAATAAATATTATTATTGAAGGG + Intergenic
949394843 3:3603626-3603648 CAACAAATATTCATGGTGCATGG + Intergenic
949753527 3:7382065-7382087 CATAAAATATTATTGATGAATGG - Intronic
949837424 3:8284221-8284243 CAATAAAAATTTTTGGTGAATGG - Intergenic
950170546 3:10836009-10836031 GAATGGAGATTAATGGTGAATGG - Intronic
954505383 3:51066288-51066310 CACTAAATATTTATAATGAATGG + Intronic
955083860 3:55683220-55683242 CAAGGCATAGTAATGGTGAATGG - Intronic
958693629 3:97500383-97500405 AAATATATAGTAATGGTGGAAGG + Intronic
958941666 3:100322843-100322865 CCATAAATATCAATGAAGAAAGG - Intronic
958966727 3:100566821-100566843 CAAAAAATTTTAATGGGCAAAGG - Intronic
961851103 3:129819525-129819547 AAATAAAAATTAAAGATGAAAGG + Intronic
961891205 3:130131553-130131575 CTATAAAGATTACTGGTGGAGGG - Intergenic
961919453 3:130410672-130410694 CAATAATTATTTCTTGTGAATGG + Intronic
962492176 3:135905018-135905040 CAGTAAATATTCAGGGGGAATGG + Intergenic
963289089 3:143468859-143468881 CAAGAAGTATTAAAGATGAAGGG + Intronic
963527121 3:146429196-146429218 CAATCAAGATGAAAGGTGAAGGG + Intronic
964883669 3:161454107-161454129 AAATAAATATTTGTGGTGACAGG - Intergenic
965082478 3:164052352-164052374 CACTAAATCATAATGATGAATGG + Intergenic
966132312 3:176655141-176655163 CAATGAATGTTTATAGTGAAAGG + Intergenic
966348818 3:179007692-179007714 CATTATATAATAATGGTAAAGGG + Intergenic
966529260 3:180956289-180956311 CACTGAATATAAATGCTGAAGGG - Intronic
967317373 3:188161998-188162020 AAGTAAATATTAATGGAGAATGG - Intronic
967477056 3:189934231-189934253 CAATAAGTGTTAGTGGTGAAGGG - Intergenic
968063292 3:195742986-195743008 AAATCAATATTGATGGAGAATGG - Intergenic
969002595 4:3993994-3994016 CTATAAAGATTCCTGGTGAAGGG - Intergenic
970305920 4:14732659-14732681 AAAAAAAAATTAATGGTGAAAGG - Intergenic
970507991 4:16752406-16752428 AAATGAATATTAATGGAAAATGG - Intronic
970632680 4:17968156-17968178 CAATAAAAAGTAATGGCAAATGG - Intronic
971529534 4:27668483-27668505 GCATAAAAATTAATGGAGAACGG - Intergenic
971865628 4:32167726-32167748 CCATAAATATTAATTGATAAAGG + Intergenic
972153110 4:36121103-36121125 CAACAAATATTTATGTTGTAGGG - Intronic
972214958 4:36886881-36886903 CAATAACAATCAATGGGGAAAGG - Intergenic
972975943 4:44636290-44636312 CAATAAACATTAATTGAGCATGG + Intronic
973033564 4:45375794-45375816 CAATAATATTTAATGGTGAAAGG - Intergenic
973100483 4:46262474-46262496 AAATATATATTAATTGTCAATGG - Intronic
973138712 4:46738869-46738891 GAATAAATATAAATGGTTAAAGG + Intronic
974219250 4:58945641-58945663 CAATAAATAGTAATTGTACATGG + Intergenic
974560547 4:63511117-63511139 CAAAAAAAAGTAATGGGGAAAGG + Intergenic
974648602 4:64726167-64726189 CAAAATATGTTAATGGTGGAGGG - Intergenic
975424511 4:74210449-74210471 CAAAAAAAAGTAATGGGGAAAGG - Intronic
975506086 4:75139722-75139744 CAACAAAAATTAATTGTTAATGG + Intergenic
975837294 4:78437703-78437725 CAATGAAAATTAATGTTGCATGG - Intronic
976430056 4:84952336-84952358 CAATAAATATTAATGAAAAATGG - Intronic
976633647 4:87265668-87265690 CAATTAATATAAATTGTGCAGGG - Intergenic
976774630 4:88694366-88694388 CAATAAATATGGATGGCAAAGGG - Intronic
976960581 4:90967131-90967153 CAATACATCTCAATGGTAAAAGG + Intronic
977828163 4:101557863-101557885 CAATAACAAGTAATGGGGAAAGG - Intronic
979026697 4:115586579-115586601 CAAAAAAAATCAATGGGGAAAGG - Intergenic
979067611 4:116157915-116157937 CAATGAAAATTAAGTGTGAAGGG - Intergenic
979762279 4:124421032-124421054 CAATAAATACGAATGCTGCATGG + Intergenic
979804006 4:124948377-124948399 CAATGGATATTAATGATAAAAGG - Intergenic
979956883 4:126964530-126964552 CAATAAATAGGAAAGGAGAAAGG + Intergenic
980009210 4:127577814-127577836 CAATAAATATTAAAGGTATGGGG - Intergenic
980088006 4:128411481-128411503 CAAAAATTAATAATGGTGAAAGG - Intergenic
980473919 4:133285531-133285553 CAAAAAATATCAATAGAGAAAGG - Intergenic
981141000 4:141269102-141269124 CAAATAAAATTAATGGTGAGGGG - Intergenic
981966885 4:150614531-150614553 CAATAAATATAAATGAATAAGGG + Intronic
982429280 4:155304388-155304410 CTATAAATATTAATGATTACAGG + Intergenic
982510178 4:156272822-156272844 CAACAAAAATAAATAGTGAAAGG - Intergenic
982863078 4:160478858-160478880 TAATAAATATTAATGGGGCATGG - Intergenic
983248778 4:165320823-165320845 CTATAAAGGTTGATGGTGAAGGG + Intronic
983698034 4:170556555-170556577 CACTAAATATCATTGGAGAAAGG - Intergenic
983711006 4:170715259-170715281 GAATAAATTTGAATGATGAATGG - Intergenic
983720465 4:170845402-170845424 AAATACCTATTAATGGTGAAGGG - Intergenic
983768296 4:171515858-171515880 CAATAAATATGGATGGTTTATGG - Intergenic
986619353 5:9655298-9655320 CAATAAAAATTAATTGGGAAAGG + Intronic
987182549 5:15383510-15383532 CAATAAATTTTAAGAGTAAAGGG + Intergenic
987513351 5:18872447-18872469 GAATAAAAAATAATGGGGAAAGG + Intergenic
988068911 5:26261884-26261906 CAAAAATGAGTAATGGTGAAAGG - Intergenic
989500624 5:42162616-42162638 TGATAAATATTCAAGGTGAAGGG - Intergenic
989778372 5:45235764-45235786 CAATAACAAATAATGGGGAAAGG - Intergenic
989824935 5:45841844-45841866 CAATAACAATCAATGGGGAAGGG - Intergenic
990468981 5:56095893-56095915 AAATGTTTATTAATGGTGAATGG - Intergenic
990931849 5:61100627-61100649 AGGAAAATATTAATGGTGAATGG - Intronic
991350155 5:65712732-65712754 CATTAAATATAAAAGGTGAGAGG + Intronic
991558805 5:67926050-67926072 TAATAAATCTTAATAATGAAAGG + Intergenic
992321941 5:75622146-75622168 GAATAAATATTGATGGTGAAGGG - Intronic
992435593 5:76752908-76752930 CATTCCATATTAATTGTGAAAGG + Intergenic
992573887 5:78091177-78091199 CAACAAATATTTATTCTGAAAGG + Intronic
992621822 5:78601457-78601479 TAATTAATATTGATGGTGAAGGG + Intronic
992871296 5:81007976-81007998 CAATAAATACTATTGCTGGATGG - Intronic
993372776 5:87113191-87113213 TAATAAATAATAATTGTAAAAGG + Intergenic
994118813 5:96091058-96091080 CAATAAGTAGTAATGGAGACAGG - Intergenic
994257724 5:97619467-97619489 CAATAATAATCAATGGGGAAAGG - Intergenic
995171729 5:109122085-109122107 GAAGAAATATTAATGGTCAAGGG - Intronic
995396465 5:111692233-111692255 CAATAAATTCTTATGGTGTAAGG - Intronic
997128165 5:131249358-131249380 TAATAAATATTAATAGTTACTGG - Intronic
997407883 5:133666515-133666537 AAATAAATATCCATGGTTAAAGG + Intergenic
998033222 5:138891264-138891286 CAATAAAGATTACAAGTGAAAGG - Intronic
998525488 5:142839520-142839542 CAATAAATATTGAAAGTTAAAGG + Intronic
998664808 5:144284570-144284592 CATTCAATATTACTGGAGAATGG - Intronic
998987145 5:147772411-147772433 CAATAAATATCAATTATGAGGGG + Intronic
999183564 5:149688480-149688502 CAATAAATATCAATGTGGTAAGG - Intergenic
999542559 5:152589642-152589664 CAATAAATAATAATGATAAAGGG + Intergenic
999574851 5:152964408-152964430 CATAAAATATTAATGATGAAAGG + Intergenic
999620549 5:153468315-153468337 CAATAAAAAGTAATGGGGAGGGG - Intergenic
1000563741 5:162822714-162822736 AAATAAATCTGAATGGTAAAAGG + Intergenic
1000697329 5:164403923-164403945 AAATAAACAGTAATGGTCAAAGG + Intergenic
1003010864 6:2426348-2426370 CAATAAATATTTGAGGTGATAGG - Intergenic
1003200059 6:3951170-3951192 CAATAACTCTTAGTGCTGAAAGG - Intergenic
1004766292 6:18731423-18731445 CAATAAAAAATAATGAGGAAAGG + Intergenic
1004810455 6:19255025-19255047 CTGCAAATATTAATGTTGAATGG - Intergenic
1005827969 6:29646915-29646937 CAATAAATATTTATGGAATAGGG + Intergenic
1007190658 6:40014789-40014811 CAATAACTTTAAATGGGGAAAGG - Intergenic
1007888612 6:45262393-45262415 CAATAACAAGTAATGGGGAAAGG + Intronic
1008549827 6:52617631-52617653 CAATATCCATTAATGGGGAATGG + Intergenic
1008807200 6:55444121-55444143 CAATAAATATCAATGACAAAGGG + Intronic
1009680480 6:66885306-66885328 AAATAAATATGAAAGCTGAAAGG + Intergenic
1009982230 6:70740720-70740742 CAATAACAATTAAGTGTGAATGG - Intronic
1010270560 6:73911700-73911722 CAGTAAAGATTAATGGACAAAGG + Intergenic
1011014489 6:82740013-82740035 CAATTAATCTTTAGGGTGAAAGG + Intergenic
1011918553 6:92541723-92541745 TAAAAAATATTAATAGTGAATGG + Intergenic
1011961280 6:93093359-93093381 CAAAAAAAAGTAAAGGTGAATGG - Intergenic
1011991989 6:93533093-93533115 CAAAAAATATTTATAGTAAATGG + Intergenic
1012152767 6:95776025-95776047 CAAAAACAATTAATGGGGAAAGG - Intergenic
1012317945 6:97803277-97803299 CAATACATTTTAAGGGTTAAAGG - Intergenic
1012391620 6:98747407-98747429 CAACAAAAATCAATGGAGAAAGG + Intergenic
1012456467 6:99411880-99411902 CAAAAAGTATTAATAGGGAAAGG + Intronic
1012482797 6:99686678-99686700 CAAAAAAATTTAATGGGGAAAGG - Intergenic
1015116237 6:129652345-129652367 CAATAAAAATGAATGGGTAAAGG - Intronic
1015274029 6:131366009-131366031 CAATATGTATTCATGGAGAAAGG - Intergenic
1016186257 6:141201163-141201185 AATTATGTATTAATGGTGAAGGG - Intergenic
1016554587 6:145322041-145322063 AGATATATATTAATGATGAAAGG + Intergenic
1017349547 6:153423610-153423632 CAATAAACATTACTGGAAAAGGG - Intergenic
1018536792 6:164828730-164828752 CAAGAAATATAAATGGTGACTGG - Intergenic
1018561048 6:165101183-165101205 CAAGAAATATTGATGGGAAAAGG - Intergenic
1020466936 7:8490731-8490753 CAATAAATATTTAAGGGGGAAGG + Intronic
1022458352 7:30579247-30579269 CAATATATGTTACTGGTGGAGGG + Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024295549 7:47839228-47839250 CAATAATTAATAATTGTGAAGGG + Intronic
1024599163 7:50964418-50964440 CAAAATATGTTAATGGTGGAAGG - Intergenic
1024712319 7:52029948-52029970 CATTAAATATAAATGTTGATGGG - Intergenic
1025638422 7:63345748-63345770 CAATAAATAATACTGATGATAGG + Intergenic
1025644274 7:63402341-63402363 CAATAAATAATACTGATGATAGG - Intergenic
1026557966 7:71424138-71424160 CAAATAATATTAATAGTGTAAGG + Intronic
1027357213 7:77369500-77369522 ATATAAAAAGTAATGGTGAAAGG + Intronic
1027511465 7:79087400-79087422 GAATCTATGTTAATGGTGAATGG - Intronic
1028101157 7:86822614-86822636 CGAGAGATATGAATGGTGAATGG + Intronic
1028435485 7:90798349-90798371 CCAGAAGTATTAATGGGGAAAGG - Intronic
1029853152 7:103485768-103485790 CAATAAATAGAAATGGAGGATGG - Intronic
1030464578 7:109884267-109884289 CATTAAATTTTAAAGGAGAATGG - Intergenic
1030569365 7:111202971-111202993 CTATAAACATTAATGGTTATGGG + Intronic
1030815798 7:114035671-114035693 CAATAAATGTTTATGATAAAAGG + Intronic
1031108351 7:117573744-117573766 CAATTAATTTTATTGTTGAAAGG - Intronic
1031606748 7:123776971-123776993 CAAAAAATAATTACGGTGAAGGG + Intergenic
1031910260 7:127509400-127509422 ATATCAATATTAATGCTGAATGG - Intergenic
1032955412 7:136965226-136965248 CAACATATATTAATGGTGAGGGG + Intronic
1035817835 8:2560856-2560878 CATTTAAAATTAATGGTGATAGG - Intergenic
1035988182 8:4457619-4457641 AAATAAATATTTATGATGATTGG - Intronic
1036029413 8:4950997-4951019 CAAAAAAAATTAATAGAGAAGGG + Intronic
1036066009 8:5382259-5382281 CTAAAAATATTAAGTGTGAACGG - Intergenic
1036374632 8:8189948-8189970 CTATAAAGATTACTGGTGAAGGG + Intergenic
1036854910 8:12233199-12233221 CTATAAAGATTACTGGTGAAGGG - Intergenic
1036876268 8:12475687-12475709 CTATAAAGATTACTGGTGGAGGG - Intergenic
1037050725 8:14369956-14369978 GAATAAATATTAACAGTAAATGG - Intronic
1037302638 8:17469017-17469039 CAATAAATATTTAAAGTAAAAGG - Intergenic
1038135206 8:24778022-24778044 CCCTAAATAATACTGGTGAAGGG + Intergenic
1038903623 8:31872303-31872325 CAATAAAAAAAAATGGTAAAAGG - Intronic
1039168219 8:34710952-34710974 CAATAAGTATAAATATTGAAAGG - Intergenic
1039619516 8:38983919-38983941 TAATAACTATTAATGTTGAAAGG - Intronic
1039939216 8:42074975-42074997 AAATAAATATTAATTCTGGATGG - Intergenic
1041277449 8:56177527-56177549 CAGTCCATATTAAGGGTGAAAGG - Intronic
1041472554 8:58226524-58226546 CAAGAAATATTATTGAAGAAGGG + Intergenic
1041542881 8:59006956-59006978 CCATAAAGAATAATGCTGAATGG + Intronic
1042270177 8:66946996-66947018 CAATAACTTATAATAGTGAATGG + Exonic
1042654994 8:71086027-71086049 CAATAAATGTTGTTGCTGAAGGG + Intergenic
1042684278 8:71420783-71420805 GAATTAATATGAATGGTGAAAGG + Intronic
1042849478 8:73202377-73202399 CATAAAATTTTAATAGTGAAAGG - Intergenic
1042874696 8:73430264-73430286 GAATAAAAATCAAGGGTGAAGGG + Intronic
1043115412 8:76247117-76247139 AAATAAATTTTAATGTTAAAAGG - Intergenic
1043678437 8:82991465-82991487 AAATATATATTAAAGCTGAAGGG + Intergenic
1044197308 8:89392995-89393017 GATTAAATATAAATTGTGAATGG - Intergenic
1044329586 8:90901027-90901049 TAAAAAATATTAATGTTGAAGGG - Intronic
1045126597 8:99097728-99097750 CAAAAAACATTAATGGAGATAGG + Intronic
1045301930 8:100918725-100918747 CAATAAATATTGATGATGGGAGG - Exonic
1045654388 8:104371870-104371892 CAATAAATATTAGTTGTCTAAGG + Intronic
1046052102 8:109036291-109036313 AAATAAATATGAAAGGAGAATGG + Intergenic
1046438660 8:114230143-114230165 CAATAAATGTTAAATGTGCAAGG + Intergenic
1046449136 8:114364804-114364826 CAATAAATATTAATAATCACTGG + Intergenic
1047272731 8:123377566-123377588 CAATAAATATTAATGTAATAAGG + Intronic
1047777899 8:128088715-128088737 CCATAAATATCAACTGTGAAAGG + Intergenic
1047794621 8:128241975-128241997 CAATAAATGTGAATGAAGAATGG + Intergenic
1047797468 8:128272764-128272786 CATTAAATGTTAATGATGAAAGG - Intergenic
1048747527 8:137631438-137631460 CAAAAAATATACTTGGTGAATGG + Intergenic
1049502151 8:142972948-142972970 CAATAAAAATAAATTCTGAAAGG + Intergenic
1050083913 9:1944038-1944060 CAATGATTAAAAATGGTGAAGGG - Intergenic
1050130890 9:2410870-2410892 CATTAAATATTAATGGAGGCTGG - Intergenic
1051067277 9:13119551-13119573 GACCAGATATTAATGGTGAATGG - Exonic
1051864635 9:21666021-21666043 TAAGAAATATTAATAGTGTATGG + Intergenic
1052146703 9:25059408-25059430 CAAAAACAATTAATGGGGAAAGG - Intergenic
1052587908 9:30452534-30452556 TAAAAAGTATTAATGTTGAAGGG - Intergenic
1052663236 9:31462863-31462885 CAAGAAAAAATACTGGTGAAGGG + Intergenic
1053023589 9:34712844-34712866 CAATAAATATTGATGATGGGAGG - Intergenic
1053577431 9:39366801-39366823 CAATAAAAATGAATTATGAATGG + Intergenic
1053673391 9:40394365-40394387 CAATAAATTTTATTTGTTAAAGG - Intergenic
1053923199 9:43020724-43020746 CAATAAATTTTATTTGTTAAAGG - Intergenic
1054099006 9:60925520-60925542 CAATAAAAATGAATTATGAATGG + Intergenic
1054120404 9:61201142-61201164 CAATAAAAATGAATTATGAATGG + Intergenic
1054384494 9:64534430-64534452 CAATAAATTTTATTTGTTAAAGG - Intergenic
1054511236 9:65981923-65981945 CAATAAATTTTATTTGTTAAAGG + Intergenic
1055209765 9:73777193-73777215 GAATAAATATTTATGATGCAGGG + Intergenic
1055212683 9:73816423-73816445 CACTAAATATAAATGAAGAAAGG - Intergenic
1055959838 9:81809683-81809705 ATTTATATATTAATGGTGAATGG - Intergenic
1056469218 9:86888824-86888846 CAACAAAAATTAATTTTGAAGGG + Intergenic
1056477637 9:86968199-86968221 CAATAAAAATTAATCATCAATGG - Intergenic
1056801218 9:89693338-89693360 GAGTAAATATTAAAGGTGATTGG + Intergenic
1057224628 9:93285057-93285079 CAAAAAATAGTAATGCTAAAAGG - Intronic
1058729504 9:107836422-107836444 CACTAGCTGTTAATGGTGAAGGG - Intergenic
1060062627 9:120474718-120474740 GAATAAATAGTAAAAGTGAAAGG + Intronic
1060318875 9:122536820-122536842 CAACAAAAATAAATGGGGAAAGG - Intergenic
1061137283 9:128742165-128742187 TGATAAATATCACTGGTGAAAGG - Intronic
1185925610 X:4142509-4142531 AAATAAATATGCATGGTGTAAGG - Intergenic
1186012004 X:5144724-5144746 TAATAACTTTTAATGGTGATGGG - Intergenic
1186103907 X:6185508-6185530 TAATTAATATTAATGGGGAATGG - Intronic
1187466577 X:19532800-19532822 AAATAAATATCAGTGGTGTAAGG - Intergenic
1187852399 X:23604174-23604196 CAATGAATATTAATGCTCACAGG - Intergenic
1188536497 X:31202297-31202319 CAATGAATATTAATGGCCACAGG - Intronic
1189512185 X:41673854-41673876 CAATAAATATTGATGATGGGAGG - Intronic
1189597077 X:42579527-42579549 TAATAAATATTAATTGTGCTGGG + Intergenic
1189936232 X:46071544-46071566 AAATGAAAAGTAATGGTGAAAGG - Intergenic
1190075725 X:47315748-47315770 CAAAAAAAATTAATGGGGAGTGG + Intergenic
1190398632 X:50009895-50009917 CAATACATATTATTTGTGGAAGG - Intronic
1190595201 X:52045912-52045934 CCATCATGATTAATGGTGAAAGG + Intergenic
1190613623 X:52208161-52208183 CCATCATGATTAATGGTGAAAGG - Intergenic
1192925629 X:75752243-75752265 TAAAAAATATTATTGGTGAGGGG + Intergenic
1193181345 X:78460999-78461021 CAAAAATAATCAATGGTGAAGGG - Intergenic
1193262331 X:79423513-79423535 AAATAAATAATAAAAGTGAAAGG - Intergenic
1193577478 X:83218638-83218660 AAATAAATATTAATAGAAAATGG + Intergenic
1194012823 X:88583391-88583413 AGATAAATATTAACAGTGAATGG - Intergenic
1194313599 X:92344822-92344844 TAATAATTAATAATGTTGAATGG + Intronic
1195532909 X:105977720-105977742 CAAAAACAAGTAATGGTGAAAGG - Intergenic
1196080340 X:111624123-111624145 AAATAAATAAAAATGGGGAAAGG - Intergenic
1196484844 X:116194297-116194319 CAATAATAAGTAATGGAGAAAGG + Intergenic
1197177102 X:123497808-123497830 CAATAACAAACAATGGTGAAAGG - Intergenic
1197863112 X:130991188-130991210 CAATAAAAATTAATAGTGCAAGG + Intergenic
1198347831 X:135776334-135776356 CAACAAATATTAATTGTGCCAGG - Intergenic
1198349736 X:135793596-135793618 CAACAAATATTAATTGTGCCAGG - Intergenic
1198351639 X:135810872-135810894 CAACAAATATTAATTGTGCCAGG - Intergenic
1198353550 X:135828134-135828156 CAACAAATATTAATTGTGCCAGG - Intergenic
1198355455 X:135845390-135845412 CAACAAATATTAATTGTGCCAGG - Intergenic
1198357365 X:135862675-135862697 CAACAAATATTAATTGTGCCAGG - Intergenic
1198359279 X:135879954-135879976 CAACAAATATTAATTGTGCCAGG - Intergenic
1198420395 X:136465783-136465805 CAGTAATTTTTAATTGTGAAAGG + Intergenic
1199249863 X:145648172-145648194 AAATAAAATCTAATGGTGAAAGG + Intergenic
1200621870 Y:5458943-5458965 TAATAATTAATAATGTTGAATGG + Intronic
1201503217 Y:14668768-14668790 CAGTAATGATTAAAGGTGAAGGG + Intronic