ID: 1109755157

View in Genome Browser
Species Human (GRCh38)
Location 13:66748877-66748899
Sequence CTAGTCCTGCCCTTGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2273
Summary {0: 8, 1: 94, 2: 245, 3: 567, 4: 1359}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109755157_1109755162 0 Left 1109755157 13:66748877-66748899 CCTTGTGTCAAGGGCAGGACTAG 0: 8
1: 94
2: 245
3: 567
4: 1359
Right 1109755162 13:66748900-66748922 GTGGAGATAAGTGAATCATGGGG 0: 14
1: 739
2: 1501
3: 3755
4: 7977
1109755157_1109755160 -2 Left 1109755157 13:66748877-66748899 CCTTGTGTCAAGGGCAGGACTAG 0: 8
1: 94
2: 245
3: 567
4: 1359
Right 1109755160 13:66748898-66748920 AGGTGGAGATAAGTGAATCATGG 0: 11
1: 849
2: 1517
3: 2938
4: 5912
1109755157_1109755163 1 Left 1109755157 13:66748877-66748899 CCTTGTGTCAAGGGCAGGACTAG 0: 8
1: 94
2: 245
3: 567
4: 1359
Right 1109755163 13:66748901-66748923 TGGAGATAAGTGAATCATGGGGG 0: 10
1: 755
2: 2744
3: 7054
4: 7638
1109755157_1109755161 -1 Left 1109755157 13:66748877-66748899 CCTTGTGTCAAGGGCAGGACTAG 0: 8
1: 94
2: 245
3: 567
4: 1359
Right 1109755161 13:66748899-66748921 GGTGGAGATAAGTGAATCATGGG 0: 11
1: 755
2: 1547
3: 3758
4: 7958

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109755157 Original CRISPR CTAGTCCTGCCCTTGACACA AGG (reversed) Intronic
Too many off-targets to display for this crispr