ID: 1109755757

View in Genome Browser
Species Human (GRCh38)
Location 13:66757191-66757213
Sequence AAGTTGCTCTAGAAGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109755757_1109755760 19 Left 1109755757 13:66757191-66757213 CCCTCTGTCTTCTAGAGCAACTT 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1109755760 13:66757233-66757255 CGGTAGAACTGCCCTTCCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 76
1109755757_1109755759 -1 Left 1109755757 13:66757191-66757213 CCCTCTGTCTTCTAGAGCAACTT 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1109755759 13:66757213-66757235 TTGAAAATTCTTGTTGAAGACGG 0: 1
1: 0
2: 2
3: 38
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109755757 Original CRISPR AAGTTGCTCTAGAAGACAGA GGG (reversed) Intronic
900359353 1:2280605-2280627 AAGATGCCCGAGAAGACAGGCGG + Intronic
902346239 1:15820134-15820156 AACTTGCCCAAGAACACAGAAGG + Intergenic
902822879 1:18954295-18954317 CAGTTGCTCGAGGAGACAGCAGG - Intronic
902860529 1:19242038-19242060 AACTTGAACTAGAAGTCAGAAGG + Intronic
903409174 1:23126212-23126234 AAGTTGCTTTAGGAGGTAGAAGG - Intronic
904416662 1:30365826-30365848 AATTTTACCTAGAAGACAGAGGG - Intergenic
905537132 1:38731016-38731038 AGGTTGCTCAAGAAAAAAGAAGG - Intergenic
905745058 1:40408737-40408759 AAGTTGCTCCAGAAAAGATACGG - Exonic
907469677 1:54665199-54665221 AAGGTGCCAGAGAAGACAGAAGG + Exonic
907701765 1:56795552-56795574 CAGTTGCTATGGAAAACAGAAGG - Intronic
908061378 1:60353523-60353545 TACTTGCTTTAAAAGACAGAAGG - Intergenic
908594626 1:65673837-65673859 GAGTTGCTCTAGAATGCTGATGG - Intergenic
910272473 1:85411496-85411518 AATTTGGTGTAGAAGACAGAAGG - Intronic
911003104 1:93188569-93188591 AAGTGGCACTGGAAGATAGAAGG - Intronic
912510546 1:110187038-110187060 AAGATTTTCTAGAAGACAGTGGG + Intronic
913092262 1:115484815-115484837 AAGTTTTTAAAGAAGACAGAGGG + Intergenic
913353874 1:117896353-117896375 AAATTGCTTTAGAAGACATATGG + Intronic
915142458 1:153775983-153776005 CAGTTGCTCCAGGTGACAGAGGG - Exonic
915540963 1:156565907-156565929 AAGTTAGTTTAGAAGACACATGG + Intronic
915607661 1:156963297-156963319 ATGTCGCTCTGGAAGGCAGAAGG + Exonic
917112778 1:171567845-171567867 AAGTTGTTCTGGAAGAAAGCAGG - Intronic
918099603 1:181362150-181362172 AAGTTGCTGGAGAAAACAGCTGG - Intergenic
920549437 1:206846204-206846226 AATTTGCTCTGGAAGATGGAAGG - Intergenic
920990903 1:210938503-210938525 AATTTTATCTAGAAGACAGAGGG - Intronic
921944518 1:220877618-220877640 AAGTGGCACTAGAAAGCAGAGGG + Intergenic
923415517 1:233754886-233754908 CAGTTTCTCTAGTAGACATAAGG - Intergenic
923474710 1:234321589-234321611 AAGTTTCTATAGAAGACAACTGG - Intronic
1063582730 10:7323515-7323537 CAGTTGCCATAGAAGACAAAAGG + Intronic
1063654587 10:7975160-7975182 AAGCTTCTTTAGAAGACAGCAGG + Intronic
1065841036 10:29701233-29701255 TAGTAGCACTAGAAGAAAGATGG + Intronic
1066566917 10:36730647-36730669 GAGTGACTCTGGAAGACAGAAGG - Intergenic
1068752455 10:60610817-60610839 GAGTGGCTCTAGAAAACAGAGGG + Intronic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1070167434 10:73909479-73909501 AAGTCTCTCCAGAAGACAGTGGG + Intronic
1071752575 10:88497151-88497173 AAGTTGTTTTGGAAGACAAACGG + Intronic
1073068710 10:100779961-100779983 AAGTTGATATAAAAGAAAGAGGG - Intronic
1075464600 10:122642245-122642267 AGGAGGCTCTAGAAGACAGAAGG + Intronic
1076097487 10:127743862-127743884 AATTTGCTCTAGATTACAGCAGG - Intergenic
1078107076 11:8365268-8365290 AATTTGCTCTTGAAGAGAAAGGG - Intergenic
1078606816 11:12784445-12784467 AAGCTTGTCTAGGAGACAGAGGG + Intronic
1078617622 11:12880212-12880234 TAGTTGCCCCTGAAGACAGAGGG - Intronic
1079991123 11:27248301-27248323 AAATTGCTCTAAAACTCAGAAGG - Intergenic
1080285149 11:30602384-30602406 AATGTGCTGTAGTAGACAGATGG - Intergenic
1082142084 11:48620672-48620694 AAGTTCCTTTAGAAGTTAGAAGG - Intergenic
1083464282 11:62834813-62834835 AAGTTGGTCTAGTAGTCAGTAGG + Intronic
1086094167 11:83033976-83033998 GACTTGCTCTTGAGGACAGATGG - Intronic
1086753189 11:90525849-90525871 GAGTTAACCTAGAAGACAGAAGG + Intergenic
1088803593 11:113330282-113330304 GGCTGGCTCTAGAAGACAGAAGG - Intronic
1091198531 11:133752625-133752647 AAATATCCCTAGAAGACAGACGG + Intergenic
1091552512 12:1547314-1547336 AAGGTGCACCAGAGGACAGAGGG - Intronic
1093759590 12:22892941-22892963 ATGATACTCTTGAAGACAGAGGG - Intergenic
1095627706 12:44336880-44336902 GAATTGCTCTAGATGACAGTAGG - Intronic
1095809936 12:46362324-46362346 AACTTGATATAGAAGGCAGAAGG + Exonic
1097925191 12:65119661-65119683 AATTTACTCTAGAGGACAAATGG - Intronic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1102534742 12:113572900-113572922 AACTTGCTCAAGATCACAGAAGG + Intergenic
1108438870 13:50428257-50428279 AAGTTACTTTGGAAGACAAAAGG - Intronic
1109164277 13:59014196-59014218 CAGTTTATCCAGAAGACAGAGGG - Intergenic
1109574639 13:64238300-64238322 AAGCTGCTCAAGATGACAGGTGG - Intergenic
1109755757 13:66757191-66757213 AAGTTGCTCTAGAAGACAGAGGG - Intronic
1110166743 13:72451570-72451592 AAGTTGCTCTGGGAGTCAGTGGG - Intergenic
1112107320 13:96254833-96254855 AAGTTGTTCCAGAAAAGAGAAGG + Intronic
1113196166 13:107809280-107809302 ATGTGGCTTGAGAAGACAGATGG - Intronic
1113332319 13:109341814-109341836 AAGTTCGTCTAGAAGGTAGAAGG - Intergenic
1113583956 13:111449835-111449857 AAGTTGCTGTGGAATAGAGAGGG - Intergenic
1114142623 14:19932385-19932407 AGGGTGCTCAAGAAGACAAAGGG - Intergenic
1114650129 14:24279481-24279503 AGGTTGCCCTAAAAGACAGAAGG + Intergenic
1115849806 14:37582469-37582491 ATGCTGCTCTATAAGACAAAGGG + Intergenic
1116480931 14:45391225-45391247 AAGAGGCACTAGAAGACAGTAGG + Intergenic
1117177129 14:53156228-53156250 AAGATGATCTAGAAAACAAAAGG - Intergenic
1117568609 14:57022673-57022695 AATTTGATCTAGGAGAGAGATGG - Intergenic
1119954646 14:78783932-78783954 TAGATGCTCTATAAAACAGATGG - Intronic
1120381175 14:83781713-83781735 GAGTGGCTCTAGAAGAGAGAGGG + Intergenic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1123628202 15:22242076-22242098 AAGATGCTCTAGAAGTCCAAAGG - Intergenic
1131975912 15:97945826-97945848 GAGTTGCTCCAGGAGACAGCAGG + Intergenic
1135474771 16:22764429-22764451 AAGTTTCTCCTGAAGAAAGATGG - Intergenic
1137491710 16:48938512-48938534 AACTTGCTCAAGACCACAGATGG + Intergenic
1138264379 16:55650106-55650128 AGGTTCCTCTCTAAGACAGAGGG - Intergenic
1141325181 16:83050367-83050389 CAGCTGCTGTAGAAGACAGTTGG - Intronic
1141975741 16:87515252-87515274 AAGATGCTCTAGAAGTCCAAAGG + Intergenic
1143612084 17:8024640-8024662 AAGTAGCTCTGGACAACAGAAGG + Intergenic
1143639500 17:8188077-8188099 AAGATGCTCTAGAAGAGAAGGGG - Intergenic
1143836649 17:9698409-9698431 AGGATGCTCTGGAGGACAGATGG - Intronic
1144361301 17:14496814-14496836 CAGTAGCCCTAGAAGACACAGGG - Intergenic
1147114905 17:38291747-38291769 AAGGTGCTGTAGAAGAAACAAGG - Intergenic
1147315854 17:39619881-39619903 AAGCTGCTCTGGAACACACAGGG + Intergenic
1148360270 17:47006190-47006212 AAACTGCTGTAGAAAACAGAGGG - Intronic
1150926455 17:69537454-69537476 GAGTTGGTCTTGAAGACAGCAGG - Intronic
1151635820 17:75347153-75347175 AAGTTTCTCTAGAAACCACAGGG - Intronic
1152889234 17:82870831-82870853 AAGTTCCTCTGGAATACAGCAGG + Intronic
1153351362 18:4084024-4084046 AAGTAGCTCCAGAAGATGGATGG + Intronic
1155014667 18:21821507-21821529 AGGTAGCTCTGGAAGAAAGACGG - Intronic
1155625842 18:27833710-27833732 ACATTTTTCTAGAAGACAGAGGG - Intergenic
1157900486 18:51510868-51510890 AACTTGCACTACAAGGCAGAAGG - Intergenic
1159704461 18:71669136-71669158 AATTAGCTCTAGCAGACATAAGG + Intergenic
1163759069 19:19124066-19124088 AAGTAGTATTAGAAGACAGAAGG + Intronic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
925191436 2:1887565-1887587 AGGAGGCTCTAGAAGAAAGACGG - Exonic
930432007 2:51289971-51289993 AATTTGATCTAGTACACAGATGG + Intergenic
930977667 2:57483648-57483670 AATTTGATGTAGAAGAAAGAGGG + Intergenic
931076451 2:58719113-58719135 GAGTTGGTCTTGAAGAGAGAAGG + Intergenic
937082580 2:119151056-119151078 AAGAAGCTCCAGAATACAGAGGG + Intergenic
939121883 2:138126962-138126984 AAGTTGGTGTTGAAGGCAGAAGG + Intergenic
939297837 2:140292823-140292845 AAGCTACCCTAGAAGACAAATGG + Intronic
941721699 2:168819633-168819655 AAATTACTCTGCAAGACAGAAGG - Intronic
948936779 2:241170730-241170752 AAGTTTCCCTAGAACACAGGTGG + Intronic
1169965163 20:11209121-11209143 AAAGTGCTCTAGAAAACTGAAGG + Intergenic
1173246245 20:41339894-41339916 AATTTGTTCTAAAAGAGAGAGGG - Intergenic
1174392311 20:50225289-50225311 TATTTGATCTAGAAGACAGTGGG + Intergenic
1176960002 21:15148583-15148605 CAGATGCACTAGAAGCCAGAGGG + Intergenic
1178143085 21:29706447-29706469 AAGTTACCCCAGAATACAGAAGG + Intronic
1178158161 21:29879159-29879181 AACTTTCAGTAGAAGACAGAGGG + Intronic
1178746528 21:35256272-35256294 AAGTTTCTCAATAACACAGAAGG - Intronic
1178872384 21:36387103-36387125 AAGTTGCTCTAGAAAGAAGGCGG + Intronic
1180029719 21:45198269-45198291 AGGCTGATCAAGAAGACAGAAGG + Intronic
1183593688 22:38796797-38796819 AACTTTCTCTAGGAGACGGAAGG + Intergenic
949819033 3:8094998-8095020 AAGTCACTCAAGATGACAGAAGG - Intergenic
950766644 3:15277904-15277926 AACTTTCTCTAGAAGAAAGTGGG - Intronic
951724278 3:25739260-25739282 AATTTCCTATAAAAGACAGATGG + Intronic
952857259 3:37782576-37782598 AAGTTGACCTGGAAGCCAGATGG + Intronic
953553025 3:43919182-43919204 AAATTGCTCTAGAAGAAAGAGGG + Intergenic
954697092 3:52433628-52433650 AAGTTACTCTAGAAAACGAAGGG - Exonic
961401054 3:126643195-126643217 AAGCTGCCCCAGAAGCCAGAGGG + Intronic
962268099 3:133957794-133957816 AACTTGCTCAAGAATACATAGGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964452747 3:156827164-156827186 AAGTTTCTCAAGAAAAAAGAAGG - Intronic
964479111 3:157124370-157124392 GAGTTCCTCTATAAGAAAGAGGG - Intergenic
964713331 3:159695453-159695475 AAGTGGTTCTAGGAGTCAGAAGG - Intronic
965421378 3:168463352-168463374 AAATTACTCAAGAAGAAAGAAGG + Intergenic
967011467 3:185438789-185438811 AAGTGGCTTTAGAGGAAAGAAGG + Intronic
972919333 4:43918998-43919020 AAGCTTCACTAGAAGACAGATGG - Intergenic
973878470 4:55244550-55244572 AAGTTACTCTGGAAGCCACAGGG + Intergenic
975992625 4:80274153-80274175 AAATTACTGTAGGAGACAGAGGG + Intronic
978074894 4:104516210-104516232 AAGATGCTCTAAAAGACAAATGG - Intergenic
978562349 4:110046462-110046484 AAGTTGTTCTAGAAGTTAGATGG - Exonic
979620628 4:122795107-122795129 AAATTGCTCTAGATTACTGATGG + Intergenic
980129119 4:128802392-128802414 AAGATGCCCCAGAAGGCAGATGG - Intergenic
981502179 4:145463538-145463560 AAGTTGCTCCTGAAAATAGAGGG - Intergenic
982860667 4:160444920-160444942 TGGTTGCTCCAGAAGACAGATGG + Intergenic
983461861 4:168035585-168035607 AATATGCTCAAGAATACAGAGGG - Intergenic
986408777 5:7454142-7454164 AAGGTGCTACAGAAGACAGCTGG - Intronic
988374086 5:30410712-30410734 AAGTTTCTCTAAAATAGAGAAGG - Intergenic
988468415 5:31513270-31513292 AAGATGCTCAGGAAGACAGCAGG + Intronic
990564368 5:57014715-57014737 ATGTTGCTCTACATGGCAGAAGG + Intergenic
991371402 5:65924669-65924691 AATTATCTCTAGAATACAGACGG + Intergenic
992310319 5:75491573-75491595 ATGTTCCTTGAGAAGACAGAAGG - Intronic
993853601 5:93042470-93042492 AACTTGCTGCAGAAGATAGATGG + Intergenic
994010478 5:94896801-94896823 ACCTTGCTCTAGTAGGCAGAAGG + Intronic
996355440 5:122591362-122591384 AAATTGCTTTTGAAGACAGCAGG - Intergenic
1000671840 5:164072835-164072857 AATTTTTTCTAGAAGATAGAAGG - Intergenic
1002876765 6:1217644-1217666 TAGTTTCTCTTGAAGGCAGATGG - Intergenic
1003252826 6:4446660-4446682 AAGTAGAGTTAGAAGACAGAAGG - Intergenic
1004196191 6:13507412-13507434 ATGTTGCTCTGGAAGGCAGAAGG + Intergenic
1004200041 6:13539918-13539940 CAGCTGCTTTAGAAAACAGATGG + Intergenic
1004530937 6:16455093-16455115 CAAATGCTCTAGGAGACAGAAGG + Intronic
1006011424 6:31045771-31045793 GAGTTTCTCTAGAAAACAAAAGG - Intergenic
1006849751 6:37089743-37089765 AAGATGCACTAGAACCCAGAGGG + Intergenic
1007278157 6:40690738-40690760 AAGTTTTTCTTGGAGACAGAGGG - Intergenic
1007658332 6:43466528-43466550 AAGTTTCCCTTGAAAACAGAGGG + Intergenic
1009192431 6:60645567-60645589 GAGATGCTACAGAAGACAGAGGG + Intergenic
1010504588 6:76641586-76641608 AAGTGGCTATCGAAGACAAATGG + Intergenic
1010792991 6:80086499-80086521 CACTTCCTCTAGCAGACAGATGG + Intergenic
1011493617 6:87917156-87917178 AGGTTGCTCTTGAAGACATGAGG + Intergenic
1011508354 6:88072697-88072719 TTGTTGCTCTGGAAGAGAGAAGG - Intergenic
1012423852 6:99093438-99093460 AAGTGGCTCAAGATGACTGAGGG + Intergenic
1012668120 6:102004668-102004690 ATGTTGCACTAGAGGGCAGACGG - Intronic
1014964263 6:127727450-127727472 CAGTTGCTGCAGATGACAGATGG + Intronic
1019296458 7:278347-278369 TCGTTGCTTTTGAAGACAGATGG + Intergenic
1021993827 7:26161047-26161069 AATTTCCTCTAGAAGACAAGGGG - Intronic
1023337009 7:39180845-39180867 AAGGTGCTCTGGAAGGCAAAGGG - Intronic
1026435476 7:70393272-70393294 AAGTTCCCATAGAAGACATATGG - Intronic
1026517404 7:71084777-71084799 AATGTGTTCTATAAGACAGATGG - Intergenic
1026529263 7:71183293-71183315 GTGTAGCTCTTGAAGACAGAAGG + Intronic
1027503886 7:78990535-78990557 AAGTTGCTTTAGAAACCAGGTGG - Intronic
1032467815 7:132157569-132157591 AAGTTGTGCCAGAACACAGAAGG - Intronic
1032892375 7:136211736-136211758 AAGTTAATCTAGAAGATAAATGG - Intergenic
1032904667 7:136350216-136350238 AAGCTGCAGTAGAAGCCAGAAGG - Intergenic
1033846831 7:145443927-145443949 AAGTTGATCTATAATACAGAGGG + Intergenic
1034391926 7:150793769-150793791 ATTTTTCTCTTGAAGACAGATGG - Intronic
1035412770 7:158658502-158658524 AAGTTGCTCAAGAAGAACCATGG + Intronic
1035643981 8:1204455-1204477 AAGTTGCTCAAGACCACACACGG - Intergenic
1038263266 8:26016666-26016688 ATGTTGCTCCAGTAGAGAGATGG + Intronic
1039156188 8:34560643-34560665 AGGTTGCTTTAGAAGACACTGGG + Intergenic
1039915120 8:41854482-41854504 AAGGTGCTTTAGAAAGCAGAAGG - Intronic
1040857438 8:51962369-51962391 CAGCTGCTCTGGAAGGCAGAAGG + Intergenic
1041059960 8:54025751-54025773 CAGTTGCTGTGGAAAACAGATGG - Intergenic
1042499218 8:69490480-69490502 AAGTCACTCTATAAAACAGATGG + Intronic
1043485140 8:80691780-80691802 AAGTTGCTGAAGAAGACAATAGG - Intronic
1045341422 8:101257920-101257942 AAGTTGCTAAAGAAGACATGGGG - Intergenic
1046773242 8:118137364-118137386 AAGTTTTTCTGGAAGGCAGATGG - Intergenic
1047486481 8:125335413-125335435 AACTTGCTCAAAAACACAGAGGG + Intronic
1048417133 8:134239951-134239973 AAGTTGCTTTATAAGGTAGAAGG + Intergenic
1052540653 9:29807971-29807993 AAGTAAAACTAGAAGACAGAGGG - Intergenic
1053360732 9:37485186-37485208 AAGGTGATTTGGAAGACAGAGGG + Intergenic
1055869526 9:80857511-80857533 ATGTTGCTGGAGAAGACAAAAGG + Intergenic
1058594110 9:106596761-106596783 AAAATGATCAAGAAGACAGAGGG + Intergenic
1059420796 9:114190724-114190746 AGGTGGTACTAGAAGACAGATGG - Intronic
1059788454 9:117613004-117613026 AAGTTGAACAAGAAGAAAGAAGG - Intergenic
1060443378 9:123662988-123663010 AAGTTACTCAAAAATACAGAGGG + Intronic
1060683297 9:125585010-125585032 AAGGTTCTATAGAAGGCAGAAGG + Intronic
1185686797 X:1935518-1935540 AAGTTGCTGTCGAAGACGGGTGG + Intergenic
1186513654 X:10149945-10149967 CAGTTGCTGTAGCAGAAAGAAGG + Intergenic
1186554573 X:10544128-10544150 AATTTGCTCCAGAAGTCAAATGG - Intronic
1187754936 X:22513177-22513199 CAATTGCTCTAGAAGTAAGAGGG - Intergenic
1188874506 X:35413471-35413493 AACATGCTCTGGAAGACAAATGG - Intergenic
1189876322 X:45440295-45440317 AAAATGCTCTGGAAGACACAGGG - Intergenic
1193107466 X:77693225-77693247 AGGTGCCTCTGGAAGACAGAGGG + Intronic
1196848403 X:119915054-119915076 ATGTTGTTCTAGAAGCCAAATGG - Intronic
1197725425 X:129773247-129773269 AAGTTGTTCTAGAACACAAGAGG - Intergenic
1199364309 X:146961127-146961149 AAGTTGCTCTATAAGACACTTGG + Intergenic
1200253210 X:154564701-154564723 AAGTGGTTCGAGCAGACAGAAGG - Exonic
1200264557 X:154639714-154639736 AAGTGGTTCGAGCAGACAGAAGG + Intergenic
1200398387 X:156004434-156004456 ATGTTGCTCTGCAAGTCAGAGGG - Exonic
1200853631 Y:7912189-7912211 AATTTGGTCAAGATGACAGAAGG + Intergenic
1201571068 Y:15414831-15414853 AAGTTACCCTAGTTGACAGAGGG + Intergenic