ID: 1109756480

View in Genome Browser
Species Human (GRCh38)
Location 13:66767564-66767586
Sequence ATGTACTTTTAGAAGTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 362}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109756480_1109756484 29 Left 1109756480 13:66767564-66767586 CCTTCAAACTTCTAAAAGTACAT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1109756484 13:66767616-66767638 TGAACAGCTTGACAGTAAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 198
1109756480_1109756483 -6 Left 1109756480 13:66767564-66767586 CCTTCAAACTTCTAAAAGTACAT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1109756483 13:66767581-66767603 GTACATGGTAGGTACTTTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109756480 Original CRISPR ATGTACTTTTAGAAGTTTGA AGG (reversed) Intronic
901162357 1:7188278-7188300 ATTTCCTTTTAAAAGTTTAATGG - Intronic
902648557 1:17821366-17821388 GTGTTCTTTTAGAAGTCTTATGG + Intronic
904071506 1:27801855-27801877 ATGTTCTTTTCCAAGTTTGTGGG + Intronic
904451847 1:30618293-30618315 TTATAATTTTAGAAGTTGGAAGG - Intergenic
905081539 1:35326226-35326248 ATCTTTATTTAGAAGTTTGATGG - Intronic
905604486 1:39285658-39285680 ATGTACATTCAGGAGTGTGAAGG + Exonic
905685893 1:39907920-39907942 AAGTACTTTTAGAATTCTCAGGG - Intergenic
906965031 1:50447986-50448008 TTGCATTTTTAGAAGTGTGAGGG + Intronic
907081179 1:51623834-51623856 ATTTGCTTTTAAATGTTTGATGG - Intronic
907531104 1:55098192-55098214 ATGGACTTTTAAAATATTGAGGG - Intronic
908261980 1:62346156-62346178 ATGAACATTTAGAGGTTTCACGG - Intergenic
909155565 1:72070945-72070967 ATGGGCTTTTAGAAGTTTCAAGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909855639 1:80527025-80527047 ATGTACTTTTTAAAGTGTAATGG - Intergenic
910463101 1:87469086-87469108 ATATACTTTTAAAAGTTTATTGG - Intergenic
910494279 1:87809275-87809297 ATGTACTTTAAAAAGATTGTTGG + Intergenic
910689429 1:89950680-89950702 ATGTACTTTGATAATTTTGGAGG + Intergenic
911504777 1:98735123-98735145 TTGTTCTTTTAGAACTTGGATGG + Intronic
911817388 1:102370125-102370147 AAATACTGTTAGAATTTTGAAGG + Intergenic
912241198 1:107911115-107911137 ATGTGCTATTAGAAGTTGGGAGG - Intronic
912444403 1:109724006-109724028 ATGTTGTATTGGAAGTTTGAAGG - Intronic
914801389 1:150965115-150965137 ATGTAATTTGAGCACTTTGAGGG - Intronic
914843952 1:151270323-151270345 ATGTTTCTTTAGAATTTTGAAGG + Intergenic
916138446 1:161673739-161673761 ATGTACCTTTATTAGTTTGGTGG + Intronic
916665402 1:166962504-166962526 AGGTATTTTTTGAAGTTGGATGG - Intronic
917131968 1:171752170-171752192 GTGTATTTTTAGAACTTTGCAGG - Intergenic
917221215 1:172730761-172730783 ATGTACTTGTGTAAGTTTCAGGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920520055 1:206617212-206617234 GTTTTCTTTTAGAAGTTTTATGG - Intergenic
921341009 1:214134720-214134742 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
921570593 1:216773797-216773819 ATGCACTTTTAGAAATGAGAAGG + Intronic
921900368 1:220443804-220443826 ATTTGTTTTTAGAAATTTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
924798079 1:247307399-247307421 ATATACTTTTAGAAGATGGATGG - Intronic
1064731966 10:18340593-18340615 CTGTACTTTGACAAGTTTGCAGG + Intronic
1064898000 10:20261294-20261316 ATTTACTTCTAGGAATTTGATGG + Intronic
1064900065 10:20286599-20286621 AACTAATTTTAGAAGTTTCATGG + Exonic
1064962948 10:20986403-20986425 AAGTACTTTGGGAATTTTGAAGG - Intronic
1065430989 10:25655262-25655284 AATTTCTTTTAGAAGTTTTATGG + Intergenic
1065618963 10:27559317-27559339 ATTTAGTTTTAAAAGTTTGATGG - Intergenic
1070931265 10:80262245-80262267 AGGGACTTTTAAAAGTTTGTGGG + Intergenic
1071679492 10:87690418-87690440 ATCTACTTTTAGAAGTGAGGAGG + Intronic
1073964771 10:108976842-108976864 ATGTACATTTTAAATTTTGAGGG + Intergenic
1074166746 10:110885666-110885688 ATATAATTTTAGCAGTTTGAGGG + Intronic
1074497132 10:113989964-113989986 ATGAACTTTTTGAATTTCGAGGG - Intergenic
1074500827 10:114022679-114022701 AAGGACTTTTAGCAGTTTGGGGG - Intergenic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078587172 11:12601887-12601909 GTCTCCTTTTAGAAGTTTAATGG - Intergenic
1079614391 11:22472738-22472760 AAGGACTTTAAGAAGTTTCAGGG - Intergenic
1082142084 11:48620672-48620694 AAGTTCCTTTAGAAGTTAGAAGG - Intergenic
1082555386 11:54558007-54558029 ATTAACTTTTCGAAGTTTGGAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083074861 11:60026242-60026264 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
1083423377 11:62569120-62569142 CTTTACTTTCTGAAGTTTGATGG - Intronic
1085499934 11:77010825-77010847 ATTTTCCTTTAGAAATTTGAAGG - Intronic
1086896372 11:92317694-92317716 ATGTAATTCTAGGAGTTTGGAGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087851316 11:103033434-103033456 GTTTTCTTTTAGAAGTTTTATGG + Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088589169 11:111388017-111388039 AAGTATTTTTAGAAGTATCATGG - Intronic
1088778657 11:113112351-113112373 ATCTACTTTTAGAGGTCAGAAGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091512441 12:1142525-1142547 ATGTGCATTTATAATTTTGATGG + Intronic
1092609735 12:10159529-10159551 ATGCAATTTTAGGAGTGTGAGGG + Exonic
1094001943 12:25705146-25705168 AAGTATCTTAAGAAGTTTGAAGG + Intergenic
1094097735 12:26727034-26727056 GCCTACTTTTAGCAGTTTGAAGG - Intronic
1094678226 12:32643075-32643097 AAGTACTTTTTAAAGTTTGGAGG - Exonic
1094725346 12:33108454-33108476 ATTTACTTTAAGAATGTTGAGGG - Intergenic
1095378123 12:41556254-41556276 ATGAAAGTCTAGAAGTTTGAAGG + Intronic
1095531330 12:43190070-43190092 TTGTACTTTTAGTAGTGAGACGG + Intergenic
1095843464 12:46720292-46720314 AGGTACTTATAAAATTTTGAAGG + Intergenic
1096430175 12:51536822-51536844 CTGCAATTTTAGAAGGTTGAGGG - Intergenic
1096888572 12:54743544-54743566 ATGTACTTTTGGGAGTTCTAGGG - Intergenic
1096930535 12:55203742-55203764 ATCTATTTTTAGTAGTTTGAGGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097295000 12:57953074-57953096 ATGAACTTATATAGGTTTGAGGG + Intronic
1097702332 12:62832690-62832712 ATGTACCTTGATAAGATTGATGG - Intronic
1097906742 12:64927967-64927989 ATGTATTTTTATAATTTTGAGGG + Intergenic
1098654469 12:73010519-73010541 ATGTATTTGTATAATTTTGAGGG + Intergenic
1098753363 12:74324728-74324750 AGGTTCTTTTAGTGGTTTGATGG + Intergenic
1099064791 12:77962346-77962368 ATCTACTTTTGAATGTTTGATGG + Intronic
1099458086 12:82888669-82888691 ACTGACTTTTAAAAGTTTGAGGG + Intronic
1099725295 12:86419131-86419153 ATGAAATTTTAAAAGTTGGAGGG - Intronic
1099772027 12:87073132-87073154 ATGTATTGTTTGAAGTTTCATGG - Intergenic
1100285629 12:93163815-93163837 ATGTATTTTAGGAAGTATGAAGG - Intergenic
1100424175 12:94467179-94467201 GTTTTCTTTTAGAAGTTTTATGG - Intergenic
1100898069 12:99206991-99207013 ATGGACTCTTAGAAGAATGATGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101458354 12:104861210-104861232 AGGTACTATTAGAAGTCTTAGGG - Intronic
1101855907 12:108442592-108442614 ATGCAAGTTTTGAAGTTTGATGG - Intergenic
1102228072 12:111243360-111243382 AAGTACTATTAAAATTTTGAGGG - Intronic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1106749061 13:32739095-32739117 ATGTTCTTCTAAAACTTTGAAGG + Intronic
1107220673 13:37975592-37975614 ATGTACTTTTAAAAGGAAGAGGG + Intergenic
1107247431 13:38312831-38312853 ATGTAGTTTTCTAAGTTTTATGG - Intergenic
1107900094 13:45003479-45003501 ATGTATTTTTAAAAGATTCATGG - Intronic
1108762494 13:53586399-53586421 TTGTATTTTTAGAATTTTAATGG + Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1110015201 13:70391419-70391441 ATGTACTTTCATAATTTTGATGG + Intergenic
1110393197 13:75000005-75000027 ATGTATTTTTTTAAGTTTTAGGG - Intergenic
1110394711 13:75015804-75015826 ATCTTCTTTTAGCAGTTTTAGGG - Intergenic
1110708537 13:78624353-78624375 TGGTACTTTTAGAAGATGGAGGG - Intronic
1111023051 13:82479719-82479741 GTGAACTTTTAGAAGGTTGAGGG + Intergenic
1111508386 13:89226617-89226639 ATGTAATTTTTAATGTTTGATGG + Intergenic
1111697606 13:91644640-91644662 ATTTACTTATATATGTTTGATGG + Intronic
1112188467 13:97151010-97151032 TAGTCCTTTTAGTAGTTTGAGGG - Intergenic
1112246608 13:97740956-97740978 ATTTTCTTTTAGAATTTTGAAGG - Intergenic
1112904019 13:104395078-104395100 ATATACTTTAAGCATTTTGAGGG + Intergenic
1112968985 13:105235486-105235508 ATGTACTCTTTGAAGTTCAAGGG - Intergenic
1113095239 13:106656429-106656451 AAGTAATTATGGAAGTTTGAAGG + Intergenic
1114347080 14:21807735-21807757 ATTTTCTTTTAAAAGGTTGAGGG + Intergenic
1115839740 14:37455811-37455833 ATGCACTTTCAGAAATTTGGTGG + Intronic
1118914472 14:70090966-70090988 ATGGACCTTTAGAGGATTGATGG - Intronic
1119570434 14:75666176-75666198 AAGTTGATTTAGAAGTTTGAAGG + Intronic
1120225320 14:81784670-81784692 ATATATTTTTTGAAGTTTCATGG + Intergenic
1120380299 14:83769210-83769232 AGATACTTTTGAAAGTTTGAAGG - Intergenic
1120537329 14:85713138-85713160 AAGTACTTTTTGAAATTTAAAGG - Intergenic
1121379011 14:93444533-93444555 ATTTTCTTCTAGAAGTTTAATGG + Intronic
1122376432 14:101263016-101263038 ATTTTCTTTTAGAAGCTTTATGG + Intergenic
1124460761 15:29889388-29889410 ATGTAGTTTTAAATGTCTGAGGG + Intronic
1126839529 15:52703597-52703619 ATGTATTTTCAGATGTTTGGAGG - Intronic
1127290461 15:57565820-57565842 ATGTACTTTTAGTATACTGAGGG + Intergenic
1128246337 15:66135216-66135238 CTGTACTTTTAGAATTTCTAAGG + Intronic
1128488834 15:68125609-68125631 ATTTTCCTTTAGAATTTTGAAGG + Intronic
1129027664 15:72593433-72593455 ATTTTCTTCTAGAAGTTTTATGG + Exonic
1130458107 15:84135094-84135116 ATGTACTCTTTGAAGATGGAGGG - Intergenic
1130806019 15:87323560-87323582 ATTTTCTTCTAGAAGTTTCATGG - Intergenic
1131941596 15:97572678-97572700 AGGTACTTCTGGAATTTTGATGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1132526297 16:417000-417022 ATGTACTTTACCAAATTTGAAGG + Intergenic
1134292172 16:12910816-12910838 CTGTACTTGTACAAGTCTGAAGG + Intronic
1138672583 16:58627751-58627773 TTGTAATCTTAGAAGTTTTAAGG - Intronic
1139108437 16:63857735-63857757 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1140074723 16:71687421-71687443 ACTTACTCTTAGAAGGTTGAAGG - Intronic
1140195704 16:72853493-72853515 ATCTCCAGTTAGAAGTTTGAAGG - Intronic
1140238227 16:73178126-73178148 ATCCACATTTAGAATTTTGAAGG - Intergenic
1140677544 16:77348046-77348068 ATGAACTCTTAGAAAATTGAGGG - Intronic
1142539236 17:645095-645117 AGGTAGTTTTAAAAATTTGAAGG - Intronic
1144051563 17:11501394-11501416 ATATACTTTTAAAAATTTGTTGG - Intronic
1144357119 17:14456774-14456796 ATTTTCTCTTAGAATTTTGAAGG + Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1149293927 17:55243549-55243571 ATGTGCTTTTAGAAATTTCAGGG - Intergenic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1150705135 17:67479729-67479751 CTGTACTTTTAGAAATCAGACGG - Intronic
1153425327 18:4956563-4956585 ATGTACTTGTATAGTTTTGAGGG - Intergenic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1154206599 18:12342644-12342666 ATTTTCTCCTAGAAGTTTGATGG + Intronic
1154352150 18:13593138-13593160 ATGTACTTTTAGTAGAGTCAGGG - Intronic
1155738329 18:29252549-29252571 AAGGTCTTTTAGAAGATTGAAGG + Intergenic
1156794673 18:41029500-41029522 TTGTATTTTTTGATGTTTGAAGG + Intergenic
1157651875 18:49341316-49341338 TTGTATTTTTAGTAGTTTCACGG - Intronic
1158255013 18:55536821-55536843 AAGTACTTTTAAAAGTATGATGG - Intronic
1159139887 18:64380873-64380895 AGGTGCTGTTAGAAGTTTAATGG - Intergenic
1159572903 18:70140280-70140302 AAGTATTTTTAATAGTTTGAAGG - Intronic
1159979717 18:74763531-74763553 ATTTTATTTTAGAAGTTTAATGG + Intronic
1160876408 19:1298411-1298433 ATGTACGATTAGGAGTTTTAAGG + Intronic
1164386970 19:27780077-27780099 TTGTATTTTTAAATGTTTGATGG + Intergenic
1166896375 19:46024300-46024322 ATGTCCTTATATAAGTTTGTAGG - Intergenic
925758729 2:7162665-7162687 ATGTACTTTTTGAAGTCTTTGGG + Intergenic
926486392 2:13465341-13465363 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
927352296 2:22130757-22130779 TTCTATTTTTAGAATTTTGAAGG - Intergenic
929475697 2:42245351-42245373 CTGTACTTCCAGAACTTTGAGGG - Intronic
930931626 2:56890936-56890958 CTTTACTTTTGGAAGTTTTATGG + Intergenic
932925697 2:75971288-75971310 ATGTACTTTTATAGTTTTGAAGG - Intergenic
933106216 2:78328801-78328823 AAGTAGTTTTAGAAGTTAAAAGG - Intergenic
935000876 2:99013687-99013709 ATGTATTTTTATAGTTTTGAGGG - Intronic
935552456 2:104472380-104472402 ATCTACTTTTAGACCTTTAAGGG - Intergenic
936102985 2:109599628-109599650 ATGTATTTGTTGGAGTTTGATGG - Intronic
936693546 2:114921352-114921374 ATGTACTTTGAAATGTATGATGG - Intronic
936698891 2:114986243-114986265 GTATGCTTTTAGAAGTTTGTGGG - Intronic
936879183 2:117229412-117229434 ATGTATTTGTATAATTTTGAAGG + Intergenic
938878454 2:135558936-135558958 ATGTAATTTAAAAAGTTTAAAGG + Intronic
939550063 2:143604161-143604183 ATGTTATTTCAGAAGTTGGAGGG + Intronic
939626653 2:144485223-144485245 ATGTAATTTTAGAACTTGGAAGG - Intronic
939682056 2:145148705-145148727 ATTTTCTTTTAGAAGTTTTATGG + Intergenic
939804651 2:146758792-146758814 ATGTAAATTTAGCAGTTTGCTGG - Intergenic
940135491 2:150431143-150431165 ATGTGCTTTCAAATGTTTGATGG + Intergenic
940728810 2:157366079-157366101 ATGTCCTTATGGAAATTTGATGG - Intergenic
940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG + Intronic
941155307 2:161970632-161970654 TTGTACTTTAAGATATTTGAGGG + Intronic
941771742 2:169352561-169352583 CTGTATTTTTAAAAGTTTCAAGG - Intronic
941833343 2:169987592-169987614 ATATAATTTTAAAAGTTTGAAGG + Intronic
942938448 2:181587245-181587267 ATGTAAATTTAGAAGTTACATGG - Intronic
943127966 2:183819919-183819941 ATGTACTTGTATAGTTTTGAGGG + Intergenic
943391340 2:187272799-187272821 GTGTTCTTTTAGGAGTTTTATGG + Intergenic
943584922 2:189726845-189726867 ATTTACTTTTCTAAATTTGAGGG - Intronic
943891542 2:193293260-193293282 TTGTTCTTCTAGAAGTTTTATGG - Intergenic
944449893 2:199831969-199831991 ATGTTATTTTAAGAGTTTGAGGG - Intronic
945759564 2:213897320-213897342 ATATACTTATTGAAGGTTGAAGG - Intronic
945826344 2:214724527-214724549 ATGTACTTTTAACACTATGAAGG + Intergenic
946847151 2:223869555-223869577 CTGTCCTTATAGAAGTTAGAGGG + Intronic
947010267 2:225558341-225558363 ATTTACTTTTAGAGGCTTTAGGG + Intronic
947146545 2:227071746-227071768 ATGTATTTGTATAATTTTGAGGG - Intronic
1169936354 20:10887880-10887902 ATTTACTTCTAGAATTTTTATGG + Intergenic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1172347665 20:34216532-34216554 ATATACTTCTAGAAGTTTTATGG + Intronic
1173154714 20:40598302-40598324 ATTTACTTTTAAAAGTCTGCTGG - Intergenic
1174925294 20:54752611-54752633 GTTTTCTTCTAGAAGTTTGATGG - Intergenic
1175282822 20:57815499-57815521 ATGTTCTTTATGAAGTTCGAAGG + Intergenic
1175908274 20:62392449-62392471 ATGTCCTTTTTGAGGTCTGAGGG + Exonic
1176883287 21:14224292-14224314 ATGTAAATTCAGAAGTGTGATGG - Intronic
1176902629 21:14461686-14461708 ATGTACTTTTAAAAGCCAGAGGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177960117 21:27653820-27653842 ATATTCTTTTAGAACTTGGAGGG + Intergenic
1178546102 21:33494130-33494152 ATGTATTTTTATAATTTTAATGG - Intergenic
1179512212 21:41880550-41880572 ATGTGCATTTAGAATTTTTATGG - Intergenic
949992000 3:9587110-9587132 ATTTTCTTTTAGAACTTTTATGG + Intergenic
950882248 3:16331917-16331939 AGGTACTTTCAAAATTTTGACGG - Intronic
950990155 3:17426459-17426481 ATGTACTTTTAATAGTTGGCAGG - Intronic
951239835 3:20274782-20274804 AAGTACTTTTAGAATCATGAAGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951254829 3:20436593-20436615 ATGTATTTGAAAAAGTTTGAGGG + Intergenic
951342675 3:21508315-21508337 ATTTTCTTTTACAACTTTGAAGG - Intronic
953579721 3:44143022-44143044 ATGAATATTTATAAGTTTGACGG + Intergenic
954279446 3:49565672-49565694 ATGTACCTCTAGTAGTTAGAGGG + Intronic
954859851 3:53678507-53678529 ATTTATCTTTAGAAGTTTAAGGG + Intronic
955250185 3:57273909-57273931 ATATACTTTTAGAAGGTACAGGG + Intronic
955684674 3:61538010-61538032 ATGTGCTTAGGGAAGTTTGAAGG + Intergenic
956518197 3:70073904-70073926 ATGTACTTTTAGGAATTTATAGG + Intergenic
957281694 3:78158309-78158331 ATGTATTTGTATAATTTTGAGGG - Intergenic
957678131 3:83396525-83396547 ATGTATTTCTATAGGTTTGAGGG - Intergenic
957921509 3:86754577-86754599 ATGTATTTGTATAATTTTGAGGG + Intergenic
958067339 3:88560321-88560343 ATGTACATGTACATGTTTGAAGG + Intergenic
958700363 3:97581329-97581351 TTTTACTTTTAGAAGTTTAAAGG + Intronic
959081651 3:101808316-101808338 ATATACTTTTAAAAGCTAGAAGG - Intronic
959132634 3:102376317-102376339 ATGTACTTTTAGAAGATTGCTGG - Intronic
959645346 3:108693273-108693295 AGGTAGTTTTAAAAGTTAGAAGG - Intronic
959707472 3:109351684-109351706 ATTTACTTTTTTAAGTTTAAAGG + Intergenic
959742859 3:109740742-109740764 ATGCACTTTTTAAAGTTTAAAGG - Intergenic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
962511319 3:136103671-136103693 ATATATTTTTAAAAGTTAGAAGG - Intronic
963558112 3:146822235-146822257 ATTTTCTTTCAGAACTTTGAAGG - Intergenic
963562898 3:146888805-146888827 ATGTGCTGTTAGAATTTTTATGG - Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963668567 3:148222416-148222438 ATGTAATTTTGGAATTTTGAAGG + Intergenic
964643852 3:158937073-158937095 ATATACTTTTAGAAGTTCTAGGG + Intergenic
965203303 3:165688997-165689019 TTGTACTTTTAAAAGATTTAAGG + Intergenic
965245779 3:166265979-166266001 ATGTACTTATAGATATTTGTTGG - Intergenic
965345550 3:167544728-167544750 ATGTTCTTCTAGAATTTTTATGG - Intronic
965367583 3:167819708-167819730 ATGTGCTTTTCAAAGCTTGAAGG + Intronic
965959105 3:174407581-174407603 ATCTACCTCTAGAAGTTCGATGG + Intergenic
966089800 3:176119207-176119229 ATGGAATGTTAGAAGTGTGACGG + Intergenic
966529864 3:180964946-180964968 AGGTGATTTTAGAAGTTTGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967514036 3:190346031-190346053 ATGAACATTCAGAAGTGTGATGG + Intronic
969132952 4:5004909-5004931 ATGTGCCTTTAGGAGTTTGAGGG - Intergenic
970079640 4:12265882-12265904 ATGTATTTTTATAACTTTTATGG - Intergenic
970366167 4:15360228-15360250 ATGTATTTTTAAAAGATCGATGG - Intronic
970585129 4:17507933-17507955 ATGCACTATTAACAGTTTGATGG - Intronic
970971944 4:21995126-21995148 ATTTTCTTGTAGGAGTTTGATGG - Intergenic
971016772 4:22497037-22497059 ATGTACTTTTATAACTTTTGGGG + Intronic
971677000 4:29644629-29644651 ATGCCCTTTCAGAAGTTTAAGGG + Intergenic
971891218 4:32524768-32524790 ATTTTCTTTTACAAGTTTAATGG - Intergenic
971939436 4:33196389-33196411 ATGCATTTTTAGAAGTAGGATGG + Intergenic
972073247 4:35050530-35050552 ATGAACTTATATAAATTTGAAGG + Intergenic
972663985 4:41146151-41146173 ATGTATTTTTAGAAGTGAAAGGG - Intronic
974179765 4:58369240-58369262 ATTTTCTTCTAGAAGTTTTACGG - Intergenic
974849021 4:67383503-67383525 ATGTATTTCTATAGGTTTGACGG - Intergenic
975354962 4:73391433-73391455 TTCTACATTTAGAAGTCTGAGGG - Intergenic
975372239 4:73602634-73602656 GTGAACTTTTACAGGTTTGAGGG - Intronic
975690903 4:76962293-76962315 ATGTATGTTTAGATGTTTTAAGG + Intronic
976270822 4:83228863-83228885 ATGCACTTTAAGAGGTTTTAAGG + Intergenic
977481551 4:97584229-97584251 ATGTATTTGTATAATTTTGAGGG - Intronic
978101639 4:104848565-104848587 CTGTACTTTTAAAAGTATCAAGG - Intergenic
978891534 4:113834142-113834164 ATGGATTTTTAGCAATTTGAGGG - Intergenic
979933614 4:126664049-126664071 ATGTAGTTTTAAAACTTTTATGG + Intergenic
980287157 4:130795368-130795390 ATATAGTTTTAGGAGTCTGAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981092500 4:140746353-140746375 ATGCAATTTTAGGAGTTTAATGG - Intronic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
982967682 4:161934593-161934615 GTGTAATTTTAGAATTTTGTGGG + Intronic
984332245 4:178339044-178339066 ATATATTTTTAAAACTTTGAAGG + Intergenic
984528057 4:180880938-180880960 AGGTACTTTATGAAATTTGATGG + Intergenic
986727698 5:10611680-10611702 ATGTGTTGTTAGAAGTTTGGAGG - Intronic
987334641 5:16888133-16888155 ATGGACTTGTGGAAGTATGAGGG - Intronic
987906157 5:24079785-24079807 ATTTACTTTTAAATGTTTCATGG + Intronic
988018041 5:25585366-25585388 ATGTATTTGTATAATTTTGAGGG + Intergenic
988072865 5:26316804-26316826 ATTTTCTTTTAGAATTTTTATGG + Intergenic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990102270 5:52206012-52206034 ATGTACATTTTGAATTTTAATGG - Intergenic
990166722 5:53002829-53002851 ATTTACTTCTTGAAGTTTGATGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990567899 5:57048413-57048435 TTGTACTTATAGAAGTCTAAAGG - Intergenic
991603927 5:68381384-68381406 ATGTCCTTATAGAACTTTGTTGG - Intergenic
993390165 5:87311020-87311042 ATGTCCTTTTAGTATTTTGTGGG + Intronic
993401144 5:87453110-87453132 ATGTACATATAGCAGTTTTAGGG + Intergenic
993693667 5:91034729-91034751 TTGTACTTTTAGAATTTGGCAGG - Intronic
994408342 5:99374636-99374658 AAGTGTTTTTAGAAGTTTGTTGG + Intergenic
994544884 5:101153212-101153234 ATTTTCTTTTAGGAGTTTTATGG - Intergenic
995294523 5:110503910-110503932 ATGTCCTTATAGAATTTTAAGGG - Intronic
995897849 5:117035769-117035791 TCCTACTTTTAAAAGTTTGAAGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997804982 5:136907912-136907934 ATGTTCTTTAAGAAGCTTGGAGG + Intergenic
999007157 5:147995731-147995753 ATGTAGTTTTAAAAGTTTTAGGG + Intergenic
999110661 5:149118156-149118178 ATTTTCTTTTTGAATTTTGATGG - Intergenic
1000150250 5:158493360-158493382 TTTTACTTTTTGAAGTGTGATGG - Intergenic
1004762220 6:18679894-18679916 ATTTTCTTGTAGAAGTTTTATGG - Intergenic
1005173845 6:23021477-23021499 ATGTCCATTTATTAGTTTGAGGG - Intergenic
1005849364 6:29808949-29808971 ATTTTCTTTTAGAAATTTTATGG - Intergenic
1008876568 6:56336112-56336134 ATGTACTTTGAGAAATCTGGGGG - Intronic
1008929804 6:56926835-56926857 ATGTACTTGAAGAACTTAGAAGG + Intronic
1009552354 6:65115121-65115143 ATGTATTTGTGGAAGTTTGCAGG - Intronic
1009656712 6:66556224-66556246 ATGTATTTGTATAATTTTGATGG + Intergenic
1009834300 6:68978813-68978835 ATGAACTTTTAGAATATAGAAGG - Intronic
1010579932 6:77583105-77583127 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1010910613 6:81550668-81550690 ATTTATTATTAGAAATTTGAGGG - Intronic
1011631233 6:89326724-89326746 ATGTACTTTTTAAGGTTTTATGG - Exonic
1012595357 6:101032128-101032150 ATGAACTTTTCCAAGTTTCAAGG - Intergenic
1012856689 6:104510113-104510135 ATTTACTTTTAGAAGATGAAAGG + Intergenic
1012903133 6:105031131-105031153 ATGAAAATTTAAAAGTTTGATGG - Intronic
1013625873 6:111936286-111936308 ATACACTTTTAAAACTTTGATGG - Intergenic
1013704936 6:112821484-112821506 CTGTTCTTTTAAGAGTTTGATGG - Intergenic
1014369750 6:120589892-120589914 ATTTACGTTTAGAAGTATGAAGG + Intergenic
1014591849 6:123283164-123283186 ATGTATTTTTATAGTTTTGAAGG - Intronic
1014659565 6:124151598-124151620 GTGTACTTTCAGAAATTTGTTGG - Intronic
1014959063 6:127659762-127659784 ATGGAATTTTTGAAGTTTGCTGG - Intergenic
1015062908 6:128989173-128989195 TTGTATTGTTAGAACTTTGAAGG - Intronic
1015222582 6:130821664-130821686 TTGTATTTTTAGTAGATTGATGG - Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1016392805 6:143591913-143591935 ATCTATTTTTAGGAGATTGAAGG + Intronic
1016684178 6:146862947-146862969 ATACACTAGTAGAAGTTTGATGG - Intergenic
1016708450 6:147141569-147141591 ATTTTCTTTTAAAAGTGTGAAGG + Intergenic
1016712421 6:147189078-147189100 TGGTACTTTTAGAAGTATGAAGG + Intergenic
1016778405 6:147931356-147931378 ATGTGCTTTAATATGTTTGAAGG - Intergenic
1016850279 6:148612242-148612264 CTGAACTTTTAGAAGTTGGGAGG - Intergenic
1019997061 7:4731359-4731381 AGGTACTTTTCGAATTTTGCAGG - Intronic
1020868602 7:13598383-13598405 ATCAACTTTTAAAAATTTGATGG + Intergenic
1020896657 7:13948996-13949018 ATGTGCTTTGAGAAATTTCAAGG + Intronic
1021115600 7:16743211-16743233 ATTTCCTGCTAGAAGTTTGAGGG - Intergenic
1021162245 7:17289228-17289250 ATTTACATTTGGAAGTTTAATGG + Intergenic
1021277144 7:18665876-18665898 ATGTCCTTTTGAAAGTTTCAGGG + Intronic
1021327006 7:19284781-19284803 ATGTCTTTTTAGAAGTTTAAAGG + Intergenic
1025062791 7:55825631-55825653 ATGTTTTTTTAGTAGTTTTATGG - Intronic
1025888202 7:65619429-65619451 ATGTACTTTATTAGGTTTGATGG + Intergenic
1026812910 7:73483895-73483917 TTGTAATTTCAGCAGTTTGAGGG - Intronic
1027411430 7:77923724-77923746 ATGTACTGTTAGAAGTCAGTTGG + Intronic
1028203764 7:87993220-87993242 GTGTACATTTAGTAGTTAGAGGG - Intronic
1028748169 7:94351326-94351348 ATGTACTTTGAGTCTTTTGAGGG - Intergenic
1029666701 7:101999799-101999821 ATATAGGTTTTGAAGTTTGAGGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031739484 7:125411679-125411701 ATATTCTTTCAGAAGTTTCATGG - Intergenic
1031854182 7:126902244-126902266 ATGTACTTTATTAGGTTTGATGG - Intronic
1032141964 7:129339838-129339860 ATTTTCTTTTAGAATTTTGAAGG + Intronic
1036075362 8:5493521-5493543 ATGATCTTTTAGAAGTGTCACGG + Intergenic
1036809352 8:11856942-11856964 ATGTCCTTTTATCAGTTTGGTGG - Intronic
1036924185 8:12888226-12888248 ATGTATTTGTGGAAGATTGAAGG + Intergenic
1037028381 8:14069548-14069570 ATTTTCTTTTACAAGTTTAATGG - Intergenic
1037276391 8:17184316-17184338 TTGTACTTTTAGAAATTAGGGGG + Intronic
1038096454 8:24317570-24317592 ATTTTCTTTTAGGAGTTTTATGG - Intronic
1039388220 8:37155411-37155433 ATGTCATTTTAAAAGTTAGAAGG + Intergenic
1039427898 8:37501898-37501920 TTGTGCCTTTAGAAGTTTGATGG - Intergenic
1042184497 8:66123299-66123321 GTGTAGTTTTATAAGTTTCAGGG - Intergenic
1042574041 8:70198511-70198533 ATGTATTTTTAGAAAGTTAATGG + Intronic
1043011885 8:74891218-74891240 ATGTACATTTAAAATTTTAATGG + Intergenic
1043130787 8:76458193-76458215 TGTTACTTTTAGAAGATTGAAGG + Intergenic
1043717352 8:83504577-83504599 ATGTATTTGTAAAATTTTGAGGG + Intergenic
1043761383 8:84073129-84073151 ATGTATTTTTTGCAGTTTGAGGG + Intergenic
1044022306 8:87119957-87119979 ATGTACTGTTAGTGGTTTGCTGG + Intronic
1045494337 8:102695723-102695745 ATGTACTTTCTGAATTATGAAGG + Intergenic
1046132293 8:109980847-109980869 ATGTACTTTTACAATATTCAGGG + Intergenic
1046798657 8:118399711-118399733 ATCTACTTTCAGAAGTTTATTGG - Intronic
1047428863 8:124773018-124773040 AGGTCCTTTTATAAGTTCGATGG - Intergenic
1048242293 8:132754692-132754714 TTGTGCTGTTAGAATTTTGAGGG + Intronic
1048514776 8:135096194-135096216 ATGGAGTTTTAGCAGTTTGTTGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050470074 9:5979179-5979201 ATGTACTTTTACAAACTTGCTGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1052802170 9:32978936-32978958 ATATGCTTTTAGTAGTGTGATGG - Intronic
1052867176 9:33471282-33471304 GTGAACTTTTAAAAGTTAGAGGG + Intronic
1053188533 9:36039115-36039137 ATGAACTTTTAGAGCTTAGAAGG - Intronic
1055895693 9:81172835-81172857 GTGTTCTTCTAGAAGTTTTATGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057820642 9:98327913-98327935 ATATACTTTTAGCAGGTTAAAGG - Intronic
1059564223 9:115366849-115366871 AGATATTTTTAGAAGTCTGAGGG + Intronic
1060536192 9:124389965-124389987 ATGTATTTTTCGGAGTTTCAGGG - Intronic
1061442656 9:130616897-130616919 ATTTACTTTTTGAAGGTTCAGGG + Intronic
1186250701 X:7662658-7662680 GTGTACTTTTAAAAGCATGAAGG - Intergenic
1187530164 X:20089089-20089111 ATTTTCTTCTAGAAGTTTTATGG + Intronic
1188596205 X:31904165-31904187 ATGTACTTTTTGAAATATGAAGG + Intronic
1188786895 X:34357731-34357753 GTGTAGTTTTAGAATTTTGAAGG - Intergenic
1188897985 X:35694004-35694026 GGGTACATTTAGAAGTTTGCTGG + Intergenic
1189894793 X:45643993-45644015 ATGTAATTTTAACAGTTTGATGG - Intergenic
1190628735 X:52364545-52364567 TTGTAATTTAAAAAGTTTGAAGG - Intergenic
1190635743 X:52432223-52432245 ATTTACTGCTAGGAGTTTGATGG - Intergenic
1191820033 X:65295955-65295977 ATGTACTTTTAGTTCTTTAAAGG - Intergenic
1193251352 X:79294542-79294564 ATGTATTTGTACAATTTTGAGGG - Intergenic
1193486708 X:82092513-82092535 ATGTACTTTCAGATGGTTAAGGG + Intergenic
1193965359 X:87978231-87978253 ATGTATTTGTATAATTTTGAGGG - Intergenic
1194384943 X:93240697-93240719 ATGTATTTTTATAGTTTTGAGGG - Intergenic
1196712478 X:118777351-118777373 ATTTATTTTTAAAAATTTGAAGG + Intronic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198950343 X:142062984-142063006 ATGTATTTGTATAATTTTGAGGG + Intergenic
1201849410 Y:18461463-18461485 CTGTAGTTTTAGCACTTTGAGGG - Intergenic
1201883908 Y:18858912-18858934 CTGTAGTTTTAGCACTTTGAGGG + Intergenic