ID: 1109759260

View in Genome Browser
Species Human (GRCh38)
Location 13:66805601-66805623
Sequence CAGTGGACAAGTACCTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109759260 Original CRISPR CAGTGGACAAGTACCTGGTT GGG (reversed) Intronic
901626427 1:10627653-10627675 CAGAGGAGAACTTCCTGGTTTGG + Intronic
904535731 1:31198397-31198419 CACTGGACATGGACCAGGTTTGG - Intronic
907842312 1:58169867-58169889 AAGGGGACATGTACCTGGGTCGG - Intronic
908659790 1:66423865-66423887 AAGGGGACATGTACCTGGGTTGG + Intergenic
909229462 1:73067213-73067235 CAGTGGTGAAGTATCTGATTTGG + Intergenic
910615238 1:89190256-89190278 CAGTGGAGCAGTACCTTGTCTGG - Exonic
910628301 1:89331978-89332000 CAGTGGAGCAGTACCTTGTTTGG + Intergenic
912565886 1:110587060-110587082 CAGTGGATAAGAAACTGCTTTGG + Intergenic
916083597 1:161252358-161252380 AAGGGGACATGTACCTGGGTTGG - Intergenic
916500617 1:165383894-165383916 CAGTGTCCAAGGACCTGCTTTGG - Intergenic
920675944 1:208038820-208038842 CAGTGGACATGGACTTGGGTAGG - Exonic
921019670 1:211224416-211224438 AAGGGGACATGTACCTGGATTGG - Intergenic
922079786 1:222284504-222284526 AAGTGGACAAGCACCTGCCTTGG + Intergenic
922637213 1:227186080-227186102 CAGAGAACCAGTGCCTGGTTAGG + Intronic
924249992 1:242123050-242123072 CAGTGGATAAGATCCTGGGTGGG + Intronic
924802499 1:247337693-247337715 CCGTGGGCAAGTACCTGTGTCGG + Intergenic
1064603595 10:17016616-17016638 AAGGGGACATGTACCTGGGTTGG + Intronic
1066022325 10:31317013-31317035 CTGTGGACAAGTACCTTTTCAGG - Intergenic
1068916936 10:62442907-62442929 CAGTGGACTAGAACTTGGTCAGG - Intronic
1073206609 10:101772790-101772812 CAGTGGCCAAGCCCCCGGTTTGG + Intronic
1074613014 10:115039275-115039297 AAGGGGACATGTACCTGGGTTGG - Intergenic
1080161944 11:29187228-29187250 CAGTGGCCCTGTACATGGTTAGG - Intergenic
1082906155 11:58310465-58310487 AAGGGGACATGTACCTGGGTTGG + Intergenic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1088352071 11:108900742-108900764 CAGTGGAATTGTACCTGGTTGGG + Intronic
1088839723 11:113615155-113615177 CAGTGGACATATACCCGGTGGGG - Intergenic
1091573931 12:1714956-1714978 AAGGGGACATGTACCTGGGTTGG + Intronic
1093580592 12:20781071-20781093 AAGGGGACATGTACCTGGGTTGG + Intergenic
1093669085 12:21850824-21850846 CAGTTGACAAGTGCCTGCTTAGG - Intronic
1097056730 12:56254590-56254612 AAGTGGTGAAGTACCTGCTTCGG - Exonic
1097428286 12:59473084-59473106 AAGGGGACATGTACCTGGGTTGG - Intergenic
1098909982 12:76199076-76199098 CAGTGGACAAGAACCCTGTCAGG + Intergenic
1099376233 12:81898651-81898673 AAGGGGACATGTACCTGGGTTGG - Intergenic
1099414757 12:82372241-82372263 AAGGGGACATGTACCTGGGTTGG + Intronic
1102249957 12:111380019-111380041 CAGTGGCTAAGTTCCTGGTCTGG + Intergenic
1105762470 13:23527052-23527074 AAGGGGACATGTACCTGGGTTGG - Intergenic
1106355350 13:28976933-28976955 CAGAGGACAATTAGGTGGTTGGG + Intronic
1106585526 13:31053511-31053533 CTGTGGACAAGTGCCTGGGAAGG - Intergenic
1108542025 13:51453509-51453531 AAGTGGACAAACACCTGGTTAGG + Intronic
1109759260 13:66805601-66805623 CAGTGGACAAGTACCTGGTTGGG - Intronic
1111233921 13:85383198-85383220 AAGTAGACACCTACCTGGTTAGG + Intergenic
1116125461 14:40778585-40778607 CAGGTGACAAGTGCCTGGTCTGG - Intergenic
1116883947 14:50200361-50200383 AAGTGGACTAGGACCTAGTTTGG - Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1125505710 15:40266420-40266442 CAGTGGACAGGAACATGCTTCGG - Exonic
1126474954 15:49055527-49055549 CCATGGACAAGTACCTGTTAGGG + Intergenic
1127328561 15:57917791-57917813 CACTTGCCAAGTACCTGGCTTGG - Intergenic
1138387482 16:56645800-56645822 TAGTGGCCTAGCACCTGGTTAGG + Intronic
1143474912 17:7196931-7196953 CAGTGGCCAAGGACCTGCTCGGG - Exonic
1143885532 17:10062082-10062104 CCGTGGACATGCACCTGGGTCGG - Intronic
1147444165 17:40464633-40464655 CAGTGGAGAGGCATCTGGTTAGG + Intergenic
1155696451 18:28692276-28692298 CAGTGGGCAAAAACCTGGTGAGG + Intergenic
1156810490 18:41243784-41243806 AGGTGGAGAAGTACCTAGTTAGG + Intergenic
1157445714 18:47745515-47745537 CAGTGGACAGGTGACTGGCTGGG - Intergenic
1158013587 18:52757502-52757524 CAGTGGACAAGGAGCTGTGTGGG - Intronic
1160926725 19:1550087-1550109 GAGTGGACAAGTAGATGGGTGGG - Intergenic
1161649424 19:5475148-5475170 CAGAGGAGAAGGACCTGATTGGG + Intergenic
1167756942 19:51418637-51418659 AAGTGGACTAGGGCCTGGTTGGG - Intergenic
926049663 2:9736699-9736721 GAGTGTACAAGTACCTGTGTGGG + Intergenic
926953144 2:18265829-18265851 CAGAGGACAAGTTCCTTGTGAGG - Intronic
928617652 2:33055774-33055796 AAGGGGACATGTACCTGGGTAGG + Intronic
931540460 2:63324451-63324473 AAGGGGACATGTACCTGGGTTGG - Intronic
933278435 2:80306013-80306035 GACTGGACAAGTAACTGGATTGG + Intronic
935316875 2:101843551-101843573 CAGTGGAGAAGTAACTCGGTGGG + Intronic
937105745 2:119311129-119311151 CAGCTGAAAAGTACCTGATTGGG - Intronic
938368288 2:130753043-130753065 CAATGTACAAATACCTGTTTAGG - Intergenic
938744066 2:134260354-134260376 CAGTGGAGAGGTAACTGCTTTGG + Intronic
938967915 2:136404828-136404850 GGGTGGACAAGTACCAGCTTGGG - Intergenic
939851824 2:147313591-147313613 AAGGGGACATGTACCTGGGTTGG - Intergenic
941424417 2:165324039-165324061 CATTCAAAAAGTACCTGGTTTGG + Intronic
943535508 2:189144273-189144295 CAGTAAACAAGTACATAGTTGGG + Intronic
1169201076 20:3710508-3710530 CAGTGGCCAAGAACCTGGTGTGG - Intergenic
1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG + Intergenic
1172464800 20:35148160-35148182 CAATCAACAAGTAACTGGTTTGG - Intergenic
1173327472 20:42047090-42047112 GTGTGGACAAGTAACTTGTTGGG + Intergenic
1180161087 21:45999028-45999050 CAGTGGACCAGGACCCGCTTGGG + Intronic
1181439113 22:22926729-22926751 CAGTGGCCTAGTACCTGGATGGG - Intergenic
952940984 3:38444241-38444263 AAGGGGACATGTACCTGGATTGG + Intergenic
954232302 3:49226866-49226888 AAGTGGACATGTACCTGGGTTGG + Intronic
964064461 3:152562029-152562051 AAGGGGACATGTACCTGGGTTGG - Intergenic
968931821 4:3584447-3584469 CAGTGCCCAAGTACTTGGTCAGG + Intronic
971339839 4:25757943-25757965 CAGTGGCCAAATAAGTGGTTTGG + Intronic
974344651 4:60663162-60663184 CTGTAGACAAGTATCTTGTTGGG + Intergenic
975267425 4:72387479-72387501 CAGTTGAATAGTACCTGGTTTGG - Intronic
975507938 4:75160160-75160182 CAGTGGAAAAATACCTGCCTTGG + Intergenic
977884055 4:102237517-102237539 AAGGGGACATGTACCTGGGTTGG - Intergenic
983834967 4:172374954-172374976 AAGGGGACATGTACCTGGGTTGG + Intronic
988605542 5:32675765-32675787 AAGGGGACATGTACCTGGGTTGG + Intergenic
990116688 5:52399521-52399543 AAGGGGACATGTACCTGGGTTGG - Intergenic
995130724 5:108627726-108627748 GAGTGGACAAGTACCTAGGATGG - Intergenic
995583468 5:113623585-113623607 AAAGGGACAAGTACCTGGGTTGG + Intergenic
996541264 5:124631853-124631875 CACTGGAGAAGGATCTGGTTAGG + Intergenic
996680337 5:126223520-126223542 AAGGGGACATGTACCTGGGTTGG - Intergenic
998111417 5:139505556-139505578 AAGTGGACATGTACCCGGGTTGG - Intergenic
1000093435 5:157950065-157950087 CAGTGCACAAGTACCTTGGCTGG + Intergenic
1002082259 5:176744043-176744065 CAGGGGACAAGGGCCAGGTTAGG + Intergenic
1002882249 6:1263346-1263368 GAGTGGACAAGTTCCTCCTTGGG - Intergenic
1003805743 6:9724518-9724540 AAGGGGACATGTACCTGGGTTGG - Intronic
1007957832 6:45933331-45933353 CAGATGAAAAGCACCTGGTTAGG - Intronic
1009385988 6:63084576-63084598 AAGGGGACATGTACCTGGGTTGG + Intergenic
1013907900 6:115238926-115238948 AAGGGGACATGTACCTGGGTTGG + Intergenic
1013977371 6:116093315-116093337 AAGGGGACATGTACCTGGGTTGG - Intergenic
1014177430 6:118345952-118345974 CAGTCGGCAAGTACCTGTATAGG - Intergenic
1014808075 6:125854000-125854022 CAATGGATAAGGACCTGTTTGGG - Intronic
1015201096 6:130582300-130582322 CAGTGGAGAAGTAGCTGGCTGGG - Intergenic
1017095284 6:150799444-150799466 CTGAGGACAAGGACCTGGCTGGG - Intronic
1017236102 6:152119020-152119042 CAGTGGACAGGTTCCTTGTTCGG - Intronic
1021560330 7:21962983-21963005 CCATGGACTAGTACCGGGTTGGG + Intergenic
1021756778 7:23859858-23859880 AAGGGGACATGTACCTGGGTTGG + Intergenic
1023078010 7:36502540-36502562 AAGGGGACATGTACCTGGGTTGG + Intergenic
1037729941 8:21515923-21515945 AAGTGGTCAATTACCTGGTTAGG - Intergenic
1038552741 8:28483958-28483980 AAGTGCACAATTACCTGGTGAGG + Intronic
1039657719 8:39428190-39428212 CAGAGGACATGATCCTGGTTGGG + Intergenic
1041346481 8:56903962-56903984 CAGTGGACAAGTATGAGATTTGG + Intergenic
1042083906 8:65087560-65087582 CAATGGGAGAGTACCTGGTTTGG + Intergenic
1042508487 8:69586808-69586830 ATGTGGACAAGTCCTTGGTTGGG - Intronic
1042771849 8:72390174-72390196 AAGTGGACATGTAGCTGGGTTGG - Intergenic
1045625583 8:104044451-104044473 CAGAGGAAAAGGACTTGGTTGGG + Intronic
1046995587 8:120517955-120517977 CAATGGACAAGTCACTGGTAAGG - Exonic
1050358580 9:4805641-4805663 CAGTGGGCAGGTAGCTGGTCAGG + Intronic
1055458343 9:76493523-76493545 AAGGGGACATGTACCTGGGTTGG + Intronic
1057019922 9:91689149-91689171 CAAGGGCCAAGGACCTGGTTAGG + Intronic
1058119113 9:101119147-101119169 CTGTGGACAAGAACATGGTAAGG - Intronic
1059884619 9:118731973-118731995 CACTGGACAAGGACCTGGTCAGG - Intergenic
1188097457 X:26042335-26042357 AAGGGGACATGTACCTGGATTGG - Intergenic
1189918307 X:45878536-45878558 CATTTGCCAAGTCCCTGGTTTGG + Intergenic
1190541396 X:51481841-51481863 AAGGGGACATGTACCTGGGTTGG - Intergenic
1191206003 X:57834791-57834813 AAGGGGACATGTACCTGGGTTGG + Intergenic
1192870078 X:75176531-75176553 AAGGGGACATGTACCTGGGTTGG + Intergenic
1193247854 X:79250932-79250954 CAGTGGACAAGTACAAGCTTAGG - Intergenic
1194607382 X:95997640-95997662 CAGAGGATAACTACCTGTTTGGG - Intergenic
1199832472 X:151559993-151560015 AAGGGGACATGTACCTGGGTTGG + Intergenic
1201403711 Y:13630030-13630052 AAGAGGACATGTACCTGGTTTGG - Intergenic
1201604660 Y:15771675-15771697 AAGAGGACATGTACCTGGTTTGG - Intergenic