ID: 1109759542

View in Genome Browser
Species Human (GRCh38)
Location 13:66809266-66809288
Sequence TAGAAGAGTACCTTGAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 543}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109759538_1109759542 7 Left 1109759538 13:66809236-66809258 CCGCGCCAGGCCTTTTAAATACA 0: 1
1: 0
2: 1
3: 41
4: 325
Right 1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 543
1109759540_1109759542 -3 Left 1109759540 13:66809246-66809268 CCTTTTAAATACATTTTTAATAG 0: 1
1: 0
2: 13
3: 130
4: 1180
Right 1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 543
1109759537_1109759542 10 Left 1109759537 13:66809233-66809255 CCACCGCGCCAGGCCTTTTAAAT 0: 1
1: 6
2: 47
3: 499
4: 3895
Right 1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 543
1109759539_1109759542 2 Left 1109759539 13:66809241-66809263 CCAGGCCTTTTAAATACATTTTT 0: 1
1: 2
2: 26
3: 235
4: 1309
Right 1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109759542 Original CRISPR TAGAAGAGTACCTTGAGGCT AGG Intronic
900012221 1:124751-124773 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
900042280 1:480741-480763 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
900063721 1:715737-715759 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
900324829 1:2103584-2103606 TTGAAGAGAAGCGTGAGGCTGGG + Intronic
902188630 1:14744499-14744521 TAGGACAGTCACTTGAGGCTAGG + Intronic
903803857 1:25990172-25990194 TAGGAGAGTCGCTTGAGGCCAGG + Intronic
903946946 1:26969969-26969991 TAGAAGAGGAAACTGAGGCTCGG - Intergenic
904203397 1:28836419-28836441 CAGAAGAGTAGCTTGAACCTGGG + Intronic
904552970 1:31336586-31336608 TGGGAGAATACCTTGAGGCAAGG - Intronic
904783252 1:32966134-32966156 AAGAAGACTGCCTTGGGGCTGGG + Intergenic
905192745 1:36248366-36248388 TAGAAGGATCACTTGAGGCTAGG - Intronic
905221710 1:36452355-36452377 TGGAAGAATCACTTGAGGCTAGG - Intergenic
905459074 1:38109798-38109820 TATAAAAATACCTTAAGGCTGGG - Intergenic
906472749 1:46144827-46144849 TAGAAGACTGGGTTGAGGCTGGG + Intronic
907326852 1:53643894-53643916 TAGAAGAGGAAGATGAGGCTCGG + Intronic
907820157 1:57959511-57959533 TAGATGAGAACATTGAGGCTTGG + Intronic
908203837 1:61824650-61824672 TAGAAGAATTGCTTGAGGCCAGG - Intronic
909474524 1:76067334-76067356 TGGAAGAGTCGCTTGAGGCCAGG + Intergenic
910078267 1:83306649-83306671 TAGAAGTAGACCCTGAGGCTAGG - Intergenic
911946890 1:104122559-104122581 TAGGAGGATCCCTTGAGGCTAGG + Intergenic
912948239 1:114102520-114102542 CAGAGGAGTAGCTTGAGTCTTGG - Intronic
912948277 1:114102846-114102868 CAGAGGAGTAGCTTGAGTCTTGG - Intronic
913406750 1:118502589-118502611 TAGGGGAATACCTTGAGCCTGGG + Intergenic
913472864 1:119207292-119207314 TAGCAGAGGACCTAGATGCTGGG - Intergenic
913509084 1:119546321-119546343 TAGAAGAGTACCATGAAACCAGG + Intergenic
914696629 1:150088570-150088592 TGGGAGAGTAGCTTGAGCCTGGG - Intronic
915284287 1:154842910-154842932 TAGATGAGTAAGTTGAGGCTTGG - Intronic
915437625 1:155920631-155920653 TGGAAGGGTCCCTTGAGCCTAGG - Intronic
915938090 1:160100624-160100646 CAGAAGAGAAACTTGAGGTTAGG + Intergenic
916064916 1:161128506-161128528 TAGAAGAATCGCTTGAGCCTGGG + Intronic
917818716 1:178738299-178738321 CAGGAGAGTACCTTGAACCTGGG - Intronic
918952803 1:191160863-191160885 TGGAAGAATCCCTTGAGTCTAGG + Intergenic
919834148 1:201562313-201562335 TAGAAAAATACCTTCAGGTTGGG - Intergenic
919879545 1:201892689-201892711 TAGATAAGGACATTGAGGCTTGG - Intergenic
919924960 1:202187432-202187454 GAGATGGGTACCCTGAGGCTGGG - Intergenic
920360609 1:205413379-205413401 TAGGAGAATCTCTTGAGGCTTGG - Intronic
920713000 1:208313218-208313240 TAGATGAGAACAGTGAGGCTAGG + Intergenic
922260649 1:223941226-223941248 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
922736422 1:227984503-227984525 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
923644410 1:235802099-235802121 TAGAAGAATAGCTTGAACCTGGG + Intronic
923868946 1:237970039-237970061 TAGAAGAATCGCTTGAGCCTGGG + Intergenic
924341827 1:243043418-243043440 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
1063701320 10:8387878-8387900 TGGAAGAATATCTTGAGGCTAGG - Intergenic
1064774540 10:18761032-18761054 TAGAAGAGTATCTTGCTGCTTGG + Intergenic
1064956467 10:20916497-20916519 TAGGAGAGTCTCTTGAGCCTGGG - Intronic
1065032464 10:21601765-21601787 TCGAAGAATAACTTGAGGCCAGG - Intronic
1065358648 10:24868163-24868185 TGGAGGAGTACCTTGAGGCTTGG + Intronic
1065395882 10:25237068-25237090 TGCAAGAGTAGCTTGAGGCAAGG + Intronic
1066236336 10:33488594-33488616 CAGGAGAGTTGCTTGAGGCTTGG - Intergenic
1066362292 10:34742983-34743005 TACAAAAGGACATTGAGGCTTGG - Intronic
1066403372 10:35096375-35096397 TAGAAGGGTTACTTGAGGCCAGG + Intergenic
1066734655 10:38462126-38462148 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
1066754295 10:38695180-38695202 TAGAAGTATTGCTTGAGGCTAGG + Intergenic
1067484425 10:46634169-46634191 TAGAAGAATCTCTTGAGCCTGGG + Intergenic
1067610335 10:47707477-47707499 TAGAAGAATCTCTTGAGCCTGGG - Intergenic
1068352617 10:55868887-55868909 TACAAGAGTCACTTGAGCCTGGG - Intergenic
1068967829 10:62931585-62931607 CAGAAGAATCCCTTGAGGCTAGG + Intergenic
1069910930 10:71758730-71758752 TATAAGAATTCCCTGAGGCTAGG + Intronic
1070102638 10:73402481-73402503 TAAAACAGTAATTTGAGGCTAGG - Intronic
1070613021 10:77947341-77947363 TAGAAGGATACCTTGAGCCCAGG - Intergenic
1071318213 10:84423917-84423939 TGGAAGAATCCCTTGAGGCCAGG + Intronic
1071625746 10:87167735-87167757 TAGAAGAATCTCTTGAGCCTGGG - Intronic
1071686972 10:87768854-87768876 TAGGAGGGTCCCTTGAGGCCAGG + Intronic
1072194145 10:93101233-93101255 TAGAAGAATCCCTTGAGCCCTGG - Intergenic
1073041783 10:100612761-100612783 TAGATGAGGACCTTGAGCTTAGG + Intergenic
1073264406 10:102216426-102216448 TAGAAGAATAGCTTGAACCTGGG + Intergenic
1073439941 10:103546608-103546630 TAGATGGGAACATTGAGGCTTGG - Intronic
1074804652 10:117036607-117036629 TAGAATAGTTGCTAGAGGCTGGG + Intronic
1074838992 10:117329716-117329738 TAGGTGAATACCTTGAGGCCAGG + Intronic
1074982801 10:118633286-118633308 CAGAAGAGGACCTGGAAGCTGGG + Intergenic
1075957950 10:126540564-126540586 TAGAAGAATCACTTGAGCCTGGG + Intronic
1076757178 10:132578708-132578730 CAGAAGAGTATGTGGAGGCTGGG + Intronic
1076968552 11:116957-116979 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
1078320470 11:10329955-10329977 TATAAAAGTACCATGAGGCCAGG - Intronic
1078800111 11:14634570-14634592 TAGGAGAATAACTTGAGGCCAGG - Intronic
1079723953 11:23855937-23855959 TGGAAGAGTTCCTTGAGCCTGGG - Intergenic
1081539349 11:44018738-44018760 TAGGAGAATCACTTGAGGCTAGG + Intergenic
1084676929 11:70640722-70640744 TAGAACAGTCCCTCAAGGCTGGG + Intronic
1084818716 11:71668346-71668368 CAGAAGAGTAACTTGAATCTGGG - Intergenic
1084838293 11:71822468-71822490 AACAGGAGTACCTTGAGTCTTGG + Intergenic
1085118391 11:73950518-73950540 TGGAAGAATCCCTTGAGCCTGGG + Exonic
1085183118 11:74552822-74552844 TAGAAGGATCCCTTGAGCCTGGG - Intronic
1085831813 11:79909567-79909589 TAGAAGAGTTGCTTGACCCTGGG + Intergenic
1085888144 11:80545423-80545445 TAGAGGAGTACCGAGAGCCTTGG - Intergenic
1085968349 11:81556180-81556202 TTGAGGAGTACCTTGAGCCATGG - Intergenic
1086019860 11:82214517-82214539 TTGGAGAATACCTTGAGGCCAGG - Intergenic
1087176675 11:95102577-95102599 TAGGAGAATCCCTTGAGCCTGGG + Intronic
1088319644 11:108542173-108542195 TTAAAGAGTGCATTGAGGCTGGG - Intronic
1089305510 11:117523997-117524019 CAGATGGGAACCTTGAGGCTGGG + Intronic
1090049931 11:123369065-123369087 TAGGAGGGTCACTTGAGGCTGGG + Intergenic
1091211305 11:133863917-133863939 TAGAAGAATCCCTTGAGCCCAGG + Intergenic
1091455650 12:605398-605420 GAAAAGACTACCTTGGGGCTGGG + Intronic
1092362143 12:7845998-7846020 CAGAAGAATAGCTTGAGCCTGGG + Intronic
1092602357 12:10081035-10081057 TTGAAGAGTCCCTTGATGCATGG + Intronic
1093416678 12:18928332-18928354 TAGAATAATTCCTTGAAGCTAGG + Intergenic
1093527868 12:20124049-20124071 TGTAAGAGTAAATTGAGGCTAGG + Intergenic
1094077571 12:26494472-26494494 TATAATAGAAGCTTGAGGCTGGG + Intronic
1094537407 12:31334459-31334481 TGGAAGGGTCACTTGAGGCTGGG - Intergenic
1094783046 12:33814959-33814981 TAGAGGAAGATCTTGAGGCTGGG - Intergenic
1095183961 12:39179514-39179536 TAGGAGAATCCCTTGAGACTGGG + Intergenic
1095241231 12:39861168-39861190 GAGAAGATTACCTTGAGAATGGG - Intronic
1095551409 12:43445615-43445637 TGGAAGGATCCCTTGAGGCTAGG + Intronic
1096141371 12:49245514-49245536 TAGAAGGATTACTTGAGGCTAGG + Intronic
1096367484 12:51040873-51040895 TAGAAGAATCCCTTGAGGCCAGG + Intergenic
1096711031 12:53456169-53456191 AAAAAGAGTCACTTGAGGCTGGG + Intronic
1096750554 12:53756197-53756219 TAGAAGAGTACATGGAGGGAAGG - Intergenic
1097033697 12:56107799-56107821 TAGGAGGATAGCTTGAGGCTGGG + Intronic
1097369852 12:58764709-58764731 TGGAAGAGTCCCTTGAGCCCAGG + Intronic
1097505327 12:60460586-60460608 TAGATGAATCCCTTGAGCCTAGG - Intergenic
1098122362 12:67255720-67255742 TAGAACTGTATCTTGAGACTGGG - Intergenic
1098316328 12:69197332-69197354 TAAAGGAATACTTTGAGGCTGGG + Intergenic
1098717242 12:73845768-73845790 TAGGAGAGTCGCTTGAGCCTGGG + Intergenic
1100488443 12:95054529-95054551 TTGAAGAGTTCCTTGAGGCTAGG - Intronic
1100881225 12:99018646-99018668 TCTAAGAGTATCTTTAGGCTAGG + Intronic
1101414293 12:104495724-104495746 TAGATGAGGAAATTGAGGCTTGG + Intronic
1101713555 12:107290528-107290550 TGGAAGGATACCTTGAGGCCAGG - Intergenic
1101772533 12:107764617-107764639 TAGAAGGATACTTTGAGCCTGGG + Intergenic
1101942261 12:109108537-109108559 TGGGAGAGTAACTTGAGCCTAGG + Intronic
1102289525 12:111687734-111687756 CAGAGGAGTAACCTGAGGCTTGG + Intronic
1102641842 12:114373750-114373772 TAAAAGTTTAGCTTGAGGCTGGG - Intronic
1103867946 12:124068554-124068576 TAGAACATTGGCTTGAGGCTGGG + Intronic
1105866081 13:24460892-24460914 TGGAAGAGTCACTTGAGGCCTGG - Intronic
1106544606 13:30719141-30719163 TAGATGAGTGAATTGAGGCTTGG - Intronic
1107126769 13:36854988-36855010 CAAAAGAGCATCTTGAGGCTGGG + Intronic
1107238321 13:38200057-38200079 AAGAAAAGTAACTTTAGGCTAGG + Intergenic
1107283836 13:38767007-38767029 GAGAAGAGTACCATGAGGTGAGG + Intronic
1107469666 13:40680524-40680546 TAGAAAAGTGCTTAGAGGCTGGG - Intergenic
1107644741 13:42482204-42482226 CAGAAGAGTCACTTGAGCCTGGG + Intergenic
1107661841 13:42646883-42646905 TAAAAGAGTTCCTTCAGGCTGGG - Intergenic
1108338045 13:49466340-49466362 TGGAAGGGTAGCTTGAGCCTAGG + Intronic
1108917843 13:55637631-55637653 TAGAAGAATTGCTTGAGCCTAGG + Intergenic
1109057906 13:57575933-57575955 TATAAGAATACCTTGATCCTGGG - Intergenic
1109688928 13:65860514-65860536 TGGAAGAGGACCCTGAGCCTCGG - Intergenic
1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG + Intronic
1110186491 13:72681118-72681140 TAAAAGAGTCCCCAGAGGCTGGG - Intergenic
1111164411 13:84439734-84439756 TAGAAATGTACTTTGAGGGTAGG - Intergenic
1112526566 13:100153646-100153668 CAGAAGAGCAACTTGAGGTTGGG + Intronic
1114329438 14:21621578-21621600 TAGAAGAATCCCTTGAGGCCAGG - Intergenic
1115123470 14:29965558-29965580 TGGAAGAATCGCTTGAGGCTAGG - Intronic
1115175119 14:30553497-30553519 AAGAAGTGTACTTTGAGGCCGGG - Intergenic
1115439172 14:33412209-33412231 TAGAAGAATTGCTTGAGCCTGGG - Intronic
1115522690 14:34248631-34248653 TAGACGGATAACTTGAGGCTAGG + Intronic
1115570423 14:34661319-34661341 TATAAGAGAGACTTGAGGCTGGG + Intergenic
1115684592 14:35782717-35782739 GTAAAGAGTACATTGAGGCTGGG - Intronic
1116451155 14:45066846-45066868 TAGAAGGATCTCTTGAGGCTAGG + Intronic
1116794932 14:49380253-49380275 CAGGAGAATAGCTTGAGGCTGGG - Intergenic
1116818939 14:49609316-49609338 CAGAAGAGTTGCTTGAGTCTGGG - Intronic
1116887394 14:50234189-50234211 TAGAAGCATAGCTTGAGGCCAGG + Intergenic
1117988831 14:61414363-61414385 CAGAAGAGTAGCTTGAACCTGGG - Intronic
1118068942 14:62224008-62224030 TACAAGAGTATGATGAGGCTTGG + Intergenic
1118358760 14:65038113-65038135 TTTAAGAATACTTTGAGGCTGGG + Intronic
1118782010 14:69014797-69014819 TAGCACAGGACCTTGAGGCGAGG - Intergenic
1118954563 14:70468346-70468368 TAGAAAAAGACCTTAAGGCTGGG + Intergenic
1119041795 14:71281097-71281119 TAGAAGAATCACTTGAGCCTAGG - Intergenic
1119102693 14:71895057-71895079 TTGAAAAGTACCTTTGGGCTGGG - Intergenic
1119114774 14:72009125-72009147 CAGGAGGGTAGCTTGAGGCTGGG + Intronic
1120484970 14:85101870-85101892 TAAAAAATTAACTTGAGGCTGGG - Intergenic
1121065294 14:90957912-90957934 TAGAAGGATAGCTTGAGGCCAGG + Intronic
1122121256 14:99554646-99554668 GAGAAGAGGAGCTTGAGCCTGGG - Intronic
1122693041 14:103540256-103540278 TACCAGAGCACCTGGAGGCTTGG - Intergenic
1125255358 15:37757544-37757566 TAGAAAAGGCCATTGAGGCTGGG + Intergenic
1125618781 15:41040575-41040597 CAGAAGACAACATTGAGGCTGGG + Intronic
1126029315 15:44480603-44480625 TGGAAGGATAGCTTGAGGCTAGG + Intronic
1126624927 15:50677443-50677465 TAAAAGAGAACCCAGAGGCTGGG + Intronic
1127238499 15:57083675-57083697 TAGAAGAATCCCTTGAGCCCAGG - Intronic
1127715783 15:61648095-61648117 TAGAAGAGGAAACTGAGGCTGGG - Intergenic
1129513450 15:76141532-76141554 TAAAAAAGTACACTGAGGCTAGG - Intronic
1129744229 15:78007140-78007162 TAGGAGAGTACCCAGAGGATGGG + Intronic
1130010032 15:80144672-80144694 TAGGAGAGTCACTTGAGGCCAGG + Intergenic
1131110753 15:89763307-89763329 TGGGAGAATACCTTGAGCCTGGG + Intronic
1131193517 15:90336327-90336349 TGGAAGAGTCCCTTGAGCCCAGG - Intergenic
1131753451 15:95535037-95535059 CAGAAGAATCCCTTGAGCCTAGG - Intergenic
1132085556 15:98905569-98905591 TAGGAGGGTAGCTTGAGCCTGGG + Intronic
1132268819 15:100504535-100504557 AAGAATAGTCCATTGAGGCTGGG - Intronic
1132489023 16:214975-214997 TAGGAGAATAGCTTGAGGCCAGG + Intronic
1132920785 16:2390818-2390840 CAGAAGAATAGCTTGAAGCTGGG - Intergenic
1133802983 16:9099288-9099310 CAGAAGAGTCACTTGAGCCTGGG - Intronic
1133905387 16:10017363-10017385 GAGAAGACTACCTGGGGGCTGGG + Intronic
1134060035 16:11193880-11193902 TGGAAGAATCCCTTGAGCCTGGG - Intergenic
1134083418 16:11340148-11340170 GAGATGAGGACATTGAGGCTTGG - Intronic
1134360293 16:13524792-13524814 TAGGAGAATTGCTTGAGGCTAGG - Intergenic
1134843261 16:17418550-17418572 AAAAAAAGTAGCTTGAGGCTGGG + Intronic
1135027092 16:19006907-19006929 TAGAAGAATAGCTTGAACCTGGG - Intronic
1135099896 16:19596129-19596151 TAGATGAGGAACCTGAGGCTTGG + Intronic
1135428657 16:22362812-22362834 TGGAAGAATTGCTTGAGGCTAGG - Intronic
1135957553 16:26968525-26968547 TGGAAGAATTGCTTGAGGCTGGG + Intergenic
1136109677 16:28056983-28057005 TGGAAGAGTTCCTGGAGGCAAGG + Intronic
1137455766 16:48616714-48616736 CAGAAGGGTTGCTTGAGGCTAGG - Intronic
1138658110 16:58502165-58502187 TAGAGGAGGAAATTGAGGCTAGG - Intronic
1138709307 16:58951479-58951501 TGGAAGAATTCCTTGAGGCCAGG + Intergenic
1139105897 16:63826183-63826205 TAGAAGAGAACTTTTAGCCTTGG + Intergenic
1139116656 16:63962473-63962495 TAAATGAGTACATTGTGGCTGGG - Intergenic
1139406089 16:66718847-66718869 TAGAAGAGTGACTGGTGGCTGGG + Intergenic
1140053745 16:71506775-71506797 TGGGAGAGTCACTTGAGGCTAGG - Intronic
1140716837 16:77734326-77734348 TATAAGAGTAGCTTATGGCTGGG + Intronic
1140723550 16:77791497-77791519 CAGAAGAGCAAATTGAGGCTTGG + Intronic
1141018349 16:80470923-80470945 TAGGAGAGTCCCTTAGGGCTTGG - Intergenic
1142452125 16:90182163-90182185 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
1142512707 17:407525-407547 TACATGAGTACATTGAGGTTTGG - Intergenic
1143249202 17:5510277-5510299 CAGAAGGGTCCCTTGAGCCTAGG - Intronic
1143290424 17:5823777-5823799 TAGAAGCATCACTTGAGGCTAGG - Intronic
1143898931 17:10158417-10158439 TAGGAGAGTCACTTGAGGCCAGG + Intronic
1144126996 17:12212363-12212385 TAGAAGAGACCCCAGAGGCTGGG + Intergenic
1144810075 17:17993391-17993413 TAGAAGAATCGCTTGAGACTAGG + Intronic
1144956875 17:19023124-19023146 GAGAAAAGTGCCCTGAGGCTGGG + Intronic
1146137477 17:30335621-30335643 TGGAAGAATCCCTTGAGGCTGGG + Intergenic
1146599692 17:34204021-34204043 CAGATGAGGACCTTGAGGTTTGG + Intergenic
1146697762 17:34923501-34923523 TAGAAGAATCCCTTGAGCCCAGG + Intergenic
1147372427 17:40002287-40002309 TAGAAGTGGACCCTGAGGCCAGG + Intergenic
1147762502 17:42808456-42808478 TAGAAGGATCCCTTGAGCCTGGG + Intronic
1147867981 17:43566282-43566304 TGGGAGAATCCCTTGAGGCTAGG - Intronic
1148003368 17:44404228-44404250 TAGAAGAATCACTTGAGCCTGGG - Intronic
1148257406 17:46147479-46147501 TAGAAGAATTGCTTGAGACTAGG + Intronic
1148485072 17:47985592-47985614 TAGAACAGTGCCTGGAGGCCGGG + Intergenic
1149947756 17:60949168-60949190 TAGAATATTTCCGTGAGGCTGGG - Intronic
1151030580 17:70733523-70733545 TAGAAGAATATCTTGAACCTGGG - Intergenic
1151138954 17:71973571-71973593 TACAAAATTACCTTCAGGCTAGG + Intergenic
1151428602 17:74047713-74047735 TAGAGGAGTACCTACTGGCTGGG - Intergenic
1154244439 18:12683257-12683279 TAGGAGAATTGCTTGAGGCTGGG + Intronic
1154509589 18:15082354-15082376 TGGAAGAATAGCTTGAGGCCAGG + Intergenic
1155553464 18:26991970-26991992 TAGAAGAGAATATTGAGGATGGG + Intronic
1155656030 18:28194341-28194363 TAGGAGAATCCCTTGAGCCTGGG + Intergenic
1156320649 18:36018566-36018588 TAGAAATGTAACTTGGGGCTGGG - Intronic
1156567202 18:38205475-38205497 TAAAAGAGTACTTGTAGGCTGGG + Intergenic
1156866137 18:41890771-41890793 TGGAAGAGGACCTAGAGGCAGGG + Intergenic
1157299067 18:46466709-46466731 TAGAAGAGTAGCTTTCTGCTGGG + Intergenic
1157394284 18:47328923-47328945 TAGAAGGGTTCCTTGAGCCCAGG - Intergenic
1157633401 18:49124207-49124229 TAAAATAGAAACTTGAGGCTGGG + Intronic
1158625962 18:59071877-59071899 GAGAAGAATCCCTTGAGGCCAGG - Intergenic
1158684538 18:59601122-59601144 TAGAAGAATCACTTGAGCCTGGG - Intronic
1160645361 19:186882-186904 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
1160768529 19:820140-820162 TGGTAGAGTAACTTAAGGCTGGG - Intronic
1161802944 19:6425885-6425907 TAGGATAGGAGCTTGAGGCTTGG - Intergenic
1162031313 19:7918529-7918551 TACAACAGTGCCTGGAGGCTGGG - Intronic
1162692328 19:12443638-12443660 AAGAAGAAGACCTTCAGGCTGGG - Intronic
1162981652 19:14244185-14244207 TAGGAGAGTAGCTTGAACCTGGG + Intergenic
1163048708 19:14664476-14664498 TAGGAGGATTCCTTGAGGCTAGG + Intronic
1163223060 19:15935462-15935484 GAGGAGAATACCTGGAGGCTAGG + Intergenic
1163304403 19:16468782-16468804 TAGAAGGATTGCTTGAGGCTAGG + Intronic
1163374392 19:16921515-16921537 CAGACCAGCACCTTGAGGCTGGG - Intronic
1163950858 19:20584646-20584668 AAGAAAAGGAGCTTGAGGCTGGG + Intronic
1168094197 19:54105359-54105381 CAGAAGAATCCCTTGAGCCTGGG - Intronic
1168150237 19:54443020-54443042 TAGAACAGTATCATAAGGCTGGG + Intergenic
1168706894 19:58475578-58475600 TAGAAGACCACCCTGAGCCTGGG - Intronic
926675548 2:15616514-15616536 TAGAAGAGAACAGTGAGCCTCGG - Intronic
926704461 2:15826837-15826859 CAGATGAGAACATTGAGGCTGGG - Intergenic
927482844 2:23468148-23468170 TAGAAGAGGAGCTTGAGGCAGGG + Intronic
927696189 2:25241294-25241316 TAGGAGAATCCCTTGAGGCCAGG - Intronic
928103226 2:28451777-28451799 AAGAAGAGGACTTAGAGGCTTGG + Intergenic
928157340 2:28888669-28888691 CAGAAGAATAGCTTGAGCCTGGG + Intergenic
928620965 2:33087293-33087315 CAGAAGAATTCCTTGAGGCCAGG - Intronic
928813590 2:35260125-35260147 TAAAAGAGTACCTTGAGATGAGG - Intergenic
929158545 2:38809984-38810006 CAGAAGAATAGCTTGAGCCTGGG - Intronic
929220400 2:39458591-39458613 TAGAAGGATACCTTGAAGCCAGG + Intergenic
929497325 2:42457399-42457421 TAAAAGGGTTCCTTGAGCCTGGG + Intronic
930892162 2:56403074-56403096 CAGAAGAGTCCCTTCAGACTGGG - Intergenic
931203829 2:60127637-60127659 TGAAAGAGTACCTCGAGGCTTGG - Intergenic
933210945 2:79568304-79568326 TATAAAAGTACCTTCAGCCTGGG + Intronic
933600753 2:84327435-84327457 CAGATGAGTACATTGAGGCTGGG - Intergenic
935049113 2:99508955-99508977 TAGAAAAGTGGTTTGAGGCTGGG - Intergenic
935988572 2:108698277-108698299 TACAAGAATCACTTGAGGCTGGG + Intergenic
936167291 2:110132559-110132581 CAGAAGAATCCCTTGAGCCTGGG + Intronic
936341787 2:111640147-111640169 CAGAAGAATTCCTTGAGGCCAGG + Intergenic
936563750 2:113566237-113566259 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
937210470 2:120266185-120266207 CAGGAGAGTCACTTGAGGCTAGG + Intronic
937525378 2:122762039-122762061 TAGAAGAATCCCTTGAGCCTGGG + Intergenic
938103866 2:128516452-128516474 TAGAAGAATCACTTGAGCCTAGG - Intergenic
939379831 2:141420764-141420786 AAGAAGAGTAGCTGGAAGCTTGG - Intronic
940209580 2:151242698-151242720 TAGGAGAATCGCTTGAGGCTAGG - Intergenic
940523561 2:154782879-154782901 TAAAAGAGTACTTTTAGGCCAGG + Intronic
940782154 2:157944193-157944215 TAGAAGAATCACTTGAGCCTGGG + Intronic
941791725 2:169559266-169559288 TTTAAGAGTACTTTGTGGCTGGG - Intronic
942548801 2:177092740-177092762 CAGAAGAATGCCTTGAGGCCAGG - Intergenic
942651422 2:178172769-178172791 CAGGAGGGTCCCTTGAGGCTAGG - Intergenic
942788800 2:179734685-179734707 TATATGAGTACTTTGAGGATAGG - Intronic
943235245 2:185309338-185309360 TAAAAGAGTAACTTGAGGCCAGG - Intergenic
944606418 2:201355630-201355652 TGGGAGAGTCGCTTGAGGCTAGG + Intronic
944704625 2:202276542-202276564 TAAAATACTACCCTGAGGCTGGG + Intronic
945026571 2:205625212-205625234 TGGGAGAGTTCCTTGAGCCTGGG - Intergenic
945256268 2:207806088-207806110 CAGAAGAGTCTCTTGAGGCCAGG - Intergenic
946220698 2:218223652-218223674 TAGAAGAGGAACCTGAGGCCCGG + Intronic
946446758 2:219746595-219746617 GAGAAGAGGACCTGGAGGATGGG + Intergenic
946816146 2:223580399-223580421 CAGGAGAGGAGCTTGAGGCTAGG - Intergenic
947066852 2:226236837-226236859 TAAAAGATTACCCTGAGGCCAGG + Intergenic
947169433 2:227296501-227296523 GAGAAGAGTTCATTGAGACTTGG + Intronic
947267178 2:228295405-228295427 TAGAAGAGTATGGTGAGCCTTGG - Intergenic
947577676 2:231289372-231289394 TAGGAGAGTCACTTGAGTCTTGG + Intronic
948561646 2:238857639-238857661 TAAAATATTACATTGAGGCTGGG + Intronic
948575096 2:238944630-238944652 CAGAAGAATGGCTTGAGGCTCGG + Intergenic
949083566 2:242126806-242126828 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
1169924297 20:10766666-10766688 TAGAAGAATTACTTGAGGCTGGG + Intergenic
1169979420 20:11366472-11366494 TAGAAAAGAAACTGGAGGCTGGG - Intergenic
1169981760 20:11392727-11392749 TAGGAGAATTCCTTGAGGCCAGG - Intergenic
1172085318 20:32377564-32377586 TAGTAAGGTACCTTGAGGATGGG + Intronic
1172171454 20:32936406-32936428 TAGAAGAATACCTAGAGGAAAGG - Intronic
1172363485 20:34331393-34331415 TAGAAGGGTCACTTGAGGCCAGG + Intergenic
1172392145 20:34573076-34573098 TAGAAGGATTACTTGAGGCTAGG - Intronic
1172872530 20:38144643-38144665 TAGATGAGGAAATTGAGGCTTGG + Intronic
1174474463 20:50786672-50786694 TGGAAAAGTCCTTTGAGGCTGGG + Intergenic
1174827577 20:53782379-53782401 CAGAAGAATTGCTTGAGGCTGGG + Intergenic
1175154957 20:56964507-56964529 TAGACGAGAAAATTGAGGCTTGG - Intergenic
1175454038 20:59096381-59096403 CAGAAGAATAGCTTGAGCCTGGG - Intergenic
1176280147 20:64299339-64299361 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
1177824626 21:26068593-26068615 TAGGAGAGTTGCTTGAGGCCAGG - Intronic
1177987635 21:27997631-27997653 TGGAAGAATAGCTTGAGGCCAGG - Intergenic
1178301304 21:31455503-31455525 TAGGAGAATAGCTTGAGCCTGGG - Intronic
1178541670 21:33456957-33456979 TAGAAAAGTATATTTAGGCTGGG + Intronic
1179404539 21:41114345-41114367 TAAAAATGTACCTTTAGGCTGGG + Intergenic
1179513965 21:41893792-41893814 CAGAAGAGTCGCTTGAGCCTGGG - Intronic
1179862882 21:44200107-44200129 CAGAAGAGTCCCTTGAATCTGGG - Intergenic
1180305756 22:11123087-11123109 TAGAAGTATTGCTTGAGGCTAGG + Intergenic
1180544275 22:16485270-16485292 TAGAAGTATTGCTTGAGGCTAGG + Intergenic
1180798010 22:18616919-18616941 TGGAAGGATACCTTGAGCCTGGG + Intergenic
1181223707 22:21378347-21378369 TGGAAGGATACCTTGAGCCTGGG - Intergenic
1181255044 22:21557272-21557294 TGGAAGGATACCTTGAGCCTGGG + Intronic
1181256491 22:21566266-21566288 TTAAAGAGTACTTTGGGGCTTGG - Intronic
1183174209 22:36210855-36210877 CAGAAGGGTTACTTGAGGCTAGG - Intergenic
1184111402 22:42397728-42397750 TAGATGAGGAACTTGAGGCTAGG + Intronic
1184881557 22:47307639-47307661 AAGAAGAGTAACTTGGGGGTGGG - Intergenic
1185170515 22:49291078-49291100 TAGCAGAAATCCTTGAGGCTTGG + Intergenic
949459135 3:4271727-4271749 TAGGAGGATAGCTTGAGGCTAGG - Intronic
950033955 3:9870865-9870887 TAGAAGGATCCCTTGAGGCAAGG - Intronic
950062355 3:10082502-10082524 CAGAAGAAGACCTAGAGGCTAGG - Intronic
950312822 3:11974121-11974143 TATAAGAAGAACTTGAGGCTGGG + Intergenic
950544187 3:13629130-13629152 GAGCAGGGTACCTTGAGGCCTGG - Intronic
950807346 3:15617659-15617681 TAGAAGAATTGCTTGAGCCTAGG + Intronic
950992567 3:17455744-17455766 TGGGAGAATTCCTTGAGGCTGGG + Intronic
951023261 3:17803669-17803691 TAGAAGCAGACCTTGAGGTTAGG + Intronic
951273137 3:20652283-20652305 TATAAGAGAATATTGAGGCTGGG + Intergenic
951441739 3:22731528-22731550 TAAAGGAATACCTTGAGACTGGG + Intergenic
951585600 3:24211966-24211988 TAGAAAAGGAAATTGAGGCTGGG + Intronic
951774180 3:26290420-26290442 TAGAAGGATTGCTTGAGGCTAGG - Intergenic
951808964 3:26678399-26678421 TAGGAGAATAGCTTGAGCCTGGG + Intronic
953323112 3:41989926-41989948 TAGAAGAATTCCTTGAGCCCAGG - Intergenic
955370663 3:58348817-58348839 TAGAAGAATCCCTTGAGCCCAGG + Intronic
955705996 3:61728352-61728374 TAGGAGAATCACTTGAGGCTAGG + Intronic
955709546 3:61763835-61763857 TAGAAGAGTACAGGGAAGCTAGG - Intronic
956682976 3:71798744-71798766 TAGGAGAATCACTTGAGGCTGGG + Intergenic
958427526 3:93996603-93996625 CAGAAGAATAGCTTGAGGCTAGG - Intronic
958429718 3:94024194-94024216 TGGAAGGATCCCTTGAGGCTAGG - Intronic
958934702 3:100243806-100243828 CAGAAGAATACCTTGAACCTGGG + Intergenic
959755878 3:109898471-109898493 TAGAAGAATAGCTTGAACCTGGG - Intergenic
959964984 3:112343529-112343551 TAGAAGACTCACTTGAGGCCAGG - Intronic
960908476 3:122624913-122624935 TAGATGAGGAACTTGAGGGTAGG + Intronic
960930534 3:122844298-122844320 TAGGAGAATAACTTGAGGCCAGG - Intronic
961676355 3:128569303-128569325 CAGAAGGGTCACTTGAGGCTAGG + Intergenic
961758562 3:129147282-129147304 TAGCAGAATAGCTTGAGCCTGGG + Intronic
962536701 3:136335271-136335293 TAGATGAGCACTTTCAGGCTTGG - Intronic
963195636 3:142525938-142525960 TAGTAAATTACCCTGAGGCTGGG - Intronic
963206786 3:142644341-142644363 TAGGAGAATCCCTTGAGCCTGGG - Intronic
964087733 3:152836790-152836812 TAGAAGCTTTCCTTGTGGCTCGG - Exonic
964124004 3:153217150-153217172 TAGATGAGGACATTAAGGCTTGG + Intergenic
964797127 3:160511083-160511105 TAAAAGAATAGCTTGTGGCTGGG - Intronic
965411707 3:168339577-168339599 TAGAAGAGTACCTTGCATATAGG + Intergenic
966203125 3:177377893-177377915 AAGAAGAATCCCTTGAGCCTGGG + Intergenic
966957043 3:184892515-184892537 TAGAAAAGTACATACAGGCTAGG - Intronic
967053617 3:185808050-185808072 TAGGAGAATAGCTTGAGCCTGGG + Intronic
967069941 3:185953738-185953760 TAGATGAGGACATTGAAGCTGGG + Intergenic
967283910 3:187850319-187850341 GAGAAGATGACCTTGAGGCTTGG + Intergenic
967329451 3:188275967-188275989 TAGAAAAGTTCCTGGAGGCTGGG - Intronic
968372322 3:198232644-198232666 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
968438351 4:607866-607888 TAGAAGTGGACCCTGAGGATGGG + Intergenic
968478272 4:822865-822887 TTGCAGAGCACGTTGAGGCTCGG - Intronic
969346246 4:6572008-6572030 TCGGAGAATCCCTTGAGGCTAGG + Intergenic
969741277 4:9029115-9029137 CAGAAGAGTAACTTGAATCTGGG - Intergenic
970091004 4:12407835-12407857 TGGAATAGGCCCTTGAGGCTTGG + Intergenic
970586108 4:17515899-17515921 CAGAGGAGTACACTGAGGCTTGG + Intronic
970954359 4:21793348-21793370 CAGAAGAATTGCTTGAGGCTGGG - Intronic
971169365 4:24217505-24217527 TATAAGAGAACATGGAGGCTAGG + Intergenic
971919410 4:32917500-32917522 TAGAAGAATTGCTTGAGGCCAGG - Intergenic
973253623 4:48086269-48086291 TAGATGAAGACATTGAGGCTTGG + Intronic
973379652 4:49311368-49311390 CAGAAGAGTACCTGAGGGCTGGG - Intergenic
974008592 4:56585921-56585943 TAGATGAGAACTTTAAGGCTGGG - Intronic
974237338 4:59199088-59199110 TAGAAGTATCCCTTGAGCCTGGG - Intergenic
975209429 4:71681586-71681608 CAGAAGAATATCTTGAGCCTGGG + Intergenic
977269423 4:94898037-94898059 TAGGAGGGTCCCTTGAGCCTAGG - Intronic
977949828 4:102958018-102958040 TAGAAGTATTGCTTGAGGCTAGG + Intronic
978423465 4:108558347-108558369 AAAACCAGTACCTTGAGGCTGGG - Intergenic
978702251 4:111661980-111662002 TAGAATAGTAACAAGAGGCTGGG + Intergenic
979261008 4:118645103-118645125 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
979398650 4:120220377-120220399 TAGAAGAATTCCTTGAGCCCAGG - Intergenic
979622972 4:122816297-122816319 AAAAACAGTACCATGAGGCTGGG + Intergenic
981419410 4:144532329-144532351 TACAAGAGATACTTGAGGCTGGG - Intergenic
982221415 4:153128606-153128628 TGGGAGAGTCCCTTGAGCCTGGG + Intergenic
983049501 4:163029308-163029330 TAGAAGAATGGCTTGAGCCTAGG + Intergenic
984414141 4:179435336-179435358 AAGAATGGAACCTTGAGGCTTGG - Intergenic
985256940 4:188079653-188079675 TAGAAGAATCCCTTGAGTCCAGG + Intergenic
986282106 5:6331777-6331799 TAGGAGAATCACTTGAGGCTAGG - Intergenic
986476037 5:8134538-8134560 TAAAAGAGTTCCTTGAGGGAGGG + Intergenic
986505552 5:8446747-8446769 TATAAAATTACCTTCAGGCTAGG + Intergenic
986713509 5:10505136-10505158 TAGAAGAATCACTTGAGCCTCGG + Exonic
988584645 5:32497907-32497929 CAGAAGGATTCCTTGAGGCTAGG + Intergenic
989654607 5:43732997-43733019 TAGAAGAGTAAGTGGTGGCTGGG + Intergenic
990551341 5:56882891-56882913 TAGAAAACTTCCTTGGGGCTGGG + Intronic
990562656 5:56998323-56998345 TAGAAGAATTGCTTGAGGCCAGG - Intergenic
990994724 5:61720268-61720290 GAGAAGAGTACCTTCAGATTAGG + Intronic
991208594 5:64078482-64078504 TAGAAGAATCCCTTGAAGCCGGG - Intergenic
992091265 5:73319530-73319552 TGGAAGAGGGGCTTGAGGCTAGG - Intergenic
992191329 5:74294848-74294870 TAGAAGAGAAACCTGAAGCTTGG - Intergenic
992316343 5:75559765-75559787 TGGAAGGGTAGCTTGAGGCCAGG - Intronic
992393554 5:76351216-76351238 TAGAAGAGTCACTTGAGCTTAGG + Intronic
992904466 5:81332766-81332788 TAGAAGAGCTCTTTGAGGGTAGG + Intronic
994171945 5:96667716-96667738 GAGAAGAGTATAATGAGGCTGGG + Intronic
994258973 5:97634578-97634600 TGGAAGAATCACTTGAGGCTGGG + Intergenic
994458543 5:100046672-100046694 TTGAGGAGTACCCTGAGGCATGG + Intergenic
995194401 5:109347553-109347575 CAGCAGAGTACCTAGGGGCTTGG + Intronic
996523568 5:124453028-124453050 AGGAAGAGTACTTTCAGGCTGGG - Intergenic
996815108 5:127565819-127565841 TAGATGAGAAGCCTGAGGCTGGG + Intergenic
997189822 5:131921282-131921304 TAGAAGAATTGCTTGAGGCCAGG + Intronic
997320449 5:132973713-132973735 TAGGAGAATAGCTTGAGCCTGGG + Intergenic
997999749 5:138615616-138615638 TAAGAGAGTGCCTTAAGGCTGGG - Intronic
1000050166 5:157556132-157556154 AAGAAGAGTCACTTGAGCCTGGG - Intronic
1001207312 5:169776390-169776412 TGGAAGAATCACTTGAGGCTAGG - Intronic
1001424335 5:171613609-171613631 GATAAGAGTACCTTCTGGCTGGG - Intergenic
1002118354 5:176983127-176983149 TACAAGATTAAATTGAGGCTGGG - Intronic
1002136926 5:177113326-177113348 CAGAAGAGTACAATGAGGCAGGG - Intergenic
1002207422 5:177573136-177573158 TAGAAGGGCACCTTTCGGCTGGG + Intergenic
1002337182 5:178487921-178487943 CAGAAGAGCACATTGTGGCTGGG + Intronic
1002624460 5:180515471-180515493 TAGTAGAGGACTTTGAGGTTTGG + Intronic
1002731563 5:181338188-181338210 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
1002752973 6:135906-135928 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
1003349260 6:5300761-5300783 CAGAAGGGTAGCTTGAGCCTGGG - Intronic
1003735530 6:8873963-8873985 CAGAAGAGTCACTTGAGCCTGGG - Intergenic
1004062454 6:12211102-12211124 TATAAGAGTACTTTGAGGCCGGG + Intergenic
1004244396 6:13959150-13959172 TAAAGGAATACCTTGACGCTGGG - Intronic
1004486001 6:16067117-16067139 TAGGTGAGCACCTTGGGGCTGGG + Intergenic
1005110319 6:22274121-22274143 CAGGAGAATACCTTGAGCCTGGG + Intergenic
1005310119 6:24551069-24551091 CAGAAGAATAGCTTGAGACTGGG - Intronic
1005414229 6:25584266-25584288 CAGGAGGGTAGCTTGAGGCTAGG - Intronic
1005634524 6:27740544-27740566 TAGGAGTGTAGCTTGAGCCTAGG - Intergenic
1006585757 6:35110465-35110487 TAGGAGGGTAGCTTGAGCCTGGG - Intergenic
1007096217 6:39214799-39214821 TAGAAAAGTTCCTGTAGGCTTGG - Intronic
1007575026 6:42919814-42919836 TGGAAGAATAGCTTGAGCCTAGG + Intronic
1007786865 6:44285480-44285502 TAGGAGAATCCCTTGAGCCTCGG - Intronic
1007872196 6:45053276-45053298 TAGGAGAATCTCTTGAGGCTGGG - Intronic
1009522406 6:64699783-64699805 TTGAAGAGTTTCTGGAGGCTTGG - Intronic
1011058827 6:83238267-83238289 TAGAAGAGTAAGTAGATGCTTGG - Intronic
1011671351 6:89686330-89686352 TAGGAGAGTCACTTGAGCCTGGG + Intronic
1012067610 6:94568450-94568472 CAGAAGAATCCCTTGAGCCTAGG + Intergenic
1012490511 6:99778444-99778466 TGGGAGAATAACTTGAGGCTGGG + Intergenic
1013335112 6:109150142-109150164 TAGAAGAGTACAACGAGACTGGG - Exonic
1013487352 6:110609852-110609874 TAGAAGAATTGCTTGAGGCCAGG - Intergenic
1013785395 6:113773895-113773917 TAGGAGAGTAGCTTGAACCTGGG + Intergenic
1013967331 6:115970669-115970691 TGGAAGAATTGCTTGAGGCTAGG + Intronic
1015138736 6:129905549-129905571 TGGGAGGGTCCCTTGAGGCTAGG - Intergenic
1015356914 6:132288141-132288163 TATAAGACTAGCTTGAGGCTAGG - Intergenic
1015881229 6:137871736-137871758 TTGCAGAGCACATTGAGGCTTGG + Intronic
1015912029 6:138178605-138178627 TAGATGAGCTCCTTGAGGCTAGG - Intronic
1017267669 6:152469003-152469025 TTGAAGAGTCACTTGAGGCCAGG - Intronic
1017315466 6:153026354-153026376 TTGAAGAGTACCATGAAGCAAGG + Intronic
1018129573 6:160716144-160716166 TAGATGAGTATCTTTAGGCAGGG + Intronic
1018324968 6:162656877-162656899 TAGGAGAGTACCTGGAGGGTGGG - Intronic
1020236464 7:6359619-6359641 TAGAAGAGGACAAAGAGGCTAGG - Intergenic
1021021553 7:15604858-15604880 CAGGAGAATCCCTTGAGGCTAGG - Intergenic
1021401682 7:20217082-20217104 TAGAATAATACCTTGAGACATGG - Intronic
1022434112 7:30362820-30362842 TACAAGAATCACTTGAGGCTGGG + Intronic
1025911854 7:65835097-65835119 TAGAAGGGTCACTTGAGGCCAGG - Intergenic
1025977848 7:66383378-66383400 TAGAAGGGTCACTTGAGGCCAGG + Intronic
1026566047 7:71490553-71490575 CAGAAGGGTCCCTTGAGGCCTGG + Intronic
1026656339 7:72259846-72259868 GAGAAGTGGGCCTTGAGGCTGGG - Intronic
1026879053 7:73897035-73897057 TGGAAGAGGAGCTTGAGGTTGGG - Intergenic
1027236580 7:76302079-76302101 CAGAAGGGTCCCTTGAGGCTAGG - Intergenic
1027296046 7:76771828-76771850 TAGAAGTAGACCCTGAGGCTAGG - Intergenic
1028605856 7:92654936-92654958 TAGGAGAATAGCTTGAGCCTGGG - Intronic
1029725836 7:102403739-102403761 TAGATGAGTAGACTGAGGCTTGG + Intronic
1030030686 7:105366460-105366482 TAGAAGAATTGCTTGAGGCCGGG - Intronic
1030157659 7:106471865-106471887 TAGAAAAGTCCCTTAAGGCTTGG + Intergenic
1031185901 7:118480104-118480126 TGGAAGAATCCCTTGAGCCTAGG - Intergenic
1031316222 7:120260836-120260858 TAGAAAGGTAACTTGAGGCCGGG - Intergenic
1031592358 7:123609298-123609320 TACTGGAGTACCATGAGGCTGGG - Intronic
1031946136 7:127842743-127842765 TAGAAGAATTGCTTGAGGCCAGG - Intronic
1032259902 7:130327076-130327098 TAAAAGAGGACCATGCGGCTGGG + Intergenic
1032375497 7:131411992-131412014 TAGAAGGGTGGCTTGAGCCTGGG + Intronic
1032392422 7:131564318-131564340 TAGAAGAAAAACTTCAGGCTGGG + Intergenic
1032819485 7:135511082-135511104 TAGAAGAGTACCCGGCAGCTAGG - Intergenic
1033199023 7:139352400-139352422 TAGAAGGATCCCTTGAGCCTGGG + Intronic
1033391704 7:140935077-140935099 TAAATGGGTACCTTCAGGCTTGG - Intergenic
1033989848 7:147269967-147269989 TGGAAGAATAGCTTGAGCCTAGG + Intronic
1034045582 7:147923756-147923778 TAGAAGAATCACTTGAGCCTAGG - Intronic
1034155319 7:148951657-148951679 TGGAAGAATCTCTTGAGGCTAGG - Intergenic
1034346871 7:150391171-150391193 TAGAAGAGTCCTATGTGGCTAGG - Intronic
1035511951 8:196091-196113 TGGAAGAATAGCTTGAGTCTGGG + Intronic
1036014969 8:4772780-4772802 TAGATGAGTACCTTAAGCCCTGG - Intronic
1036478847 8:9119923-9119945 TAGAAGATTGCTTTGATGCTGGG + Intergenic
1036718610 8:11150758-11150780 TAGAAGAGTCGCTTGAGGCCGGG + Intronic
1037058451 8:14476031-14476053 TAGAAGATTTGCTTGAGGCCAGG - Intronic
1037596210 8:20356369-20356391 TGGAAGGATTCCTTGAGGCTAGG + Intergenic
1037807873 8:22068473-22068495 TGGGAGAATCCCTTGAGGCTGGG + Intronic
1038771787 8:30489535-30489557 CAGAAGAATACCTTGAACCTGGG - Intronic
1038869035 8:31473405-31473427 TAGGAGGGTAGCTTGAGCCTGGG - Intergenic
1040502224 8:48015080-48015102 GTCAAGAGTAGCTTGAGGCTGGG + Intronic
1041016401 8:53596205-53596227 TAGATGAGAACATTGAGGCTTGG - Intergenic
1041027506 8:53702370-53702392 TAGAAGAATTGCTTGAGCCTGGG - Intergenic
1042135216 8:65626374-65626396 TAGAAGAATCACTTGAGGCCAGG + Intronic
1043448458 8:80342151-80342173 CAGAAAAGGACCTTCAGGCTGGG - Intergenic
1043853248 8:85237818-85237840 TAGAAGAATCACTTGAGTCTGGG - Intronic
1044447860 8:92299374-92299396 TAGAAGAGAATCATGTGGCTAGG - Intergenic
1044469580 8:92550911-92550933 TAGAAGAATCCCTTGAACCTGGG - Intergenic
1044682744 8:94798785-94798807 AAAAAGAGTGTCTTGAGGCTGGG + Intergenic
1044838478 8:96317640-96317662 TAGAAGAATTGCTTGAGCCTGGG + Intronic
1044900447 8:96938302-96938324 TGGAAGAATCGCTTGAGGCTAGG + Intronic
1045269630 8:100650704-100650726 TAGAAAAGGAAATTGAGGCTAGG + Intronic
1045580715 8:103476735-103476757 CAGGAGAATCCCTTGAGGCTAGG + Intergenic
1045746796 8:105431825-105431847 TAGAAGAGTTGCTTGGGCCTGGG + Intronic
1047118349 8:121870682-121870704 TATACCACTACCTTGAGGCTTGG + Intergenic
1047668166 8:127115421-127115443 CAGGAGAGTCCCTTGAGGCCAGG - Intergenic
1047905360 8:129467270-129467292 AATAAGAGTTCCTTTAGGCTCGG - Intergenic
1047953248 8:129953230-129953252 TAGAAGAGTTCCTTCCAGCTTGG + Intronic
1048005360 8:130415239-130415261 CAGAAGGATAGCTTGAGGCTAGG + Intronic
1048324453 8:133428405-133428427 GAGATGAGAACATTGAGGCTCGG + Intergenic
1048509189 8:135047056-135047078 CAGGAGAGTCCCTTGAGCCTGGG - Intergenic
1049888978 9:49494-49516 TGGAAGAATAGCTTGAGTCTGGG + Intergenic
1050108219 9:2187442-2187464 CAGAAGGATAGCTTGAGGCTAGG + Intronic
1050371716 9:4928795-4928817 TAGAAGGGTTGCTTGAGGCCAGG - Intergenic
1050850375 9:10277861-10277883 TAAAAGAGTGCTTTGAGGCCGGG + Intronic
1050966974 9:11817305-11817327 TAGAAGAATCGCTTGAGTCTGGG + Intergenic
1051963400 9:22796303-22796325 TGGGAGAGTTCCTTGAGCCTGGG - Intergenic
1052254191 9:26434507-26434529 TAGATGAGGTCATTGAGGCTTGG - Intergenic
1052821521 9:33141207-33141229 AAGAAGAGGTCTTTGAGGCTGGG + Intronic
1052870584 9:33502409-33502431 CAGAAGAGTCACTTGAGCCTGGG - Intergenic
1052874237 9:33541472-33541494 TAGAAGCATCCCTTGAGGCTTGG + Intronic
1053043412 9:34893506-34893528 TAGGAGAGTCCCTTGAACCTGGG + Intergenic
1053342647 9:37350859-37350881 TAGAAGCCTACCTGGAGACTGGG - Intronic
1053501804 9:38602893-38602915 TAGAAGCATCCCTTGAGGCTTGG - Intergenic
1054742156 9:68817781-68817803 TAGAAGGGTTGCTTGAGGCCAGG - Intronic
1054955850 9:70909218-70909240 TAGAAGAGTATCCTGAGGGCAGG + Intronic
1054965519 9:71022465-71022487 TGGAAGGATAACTTGAGGCTAGG + Intronic
1055068605 9:72144127-72144149 CAGAAGAATCCCTTGAGCCTGGG + Intronic
1055195085 9:73581241-73581263 AAGAAGTGTAGCCTGAGGCTTGG + Intergenic
1055633095 9:78244421-78244443 TACAGGAGTAACTTCAGGCTGGG - Intronic
1056030961 9:82552735-82552757 AAGAAGAGGACCCTGAGGCAAGG - Intergenic
1057154290 9:92826824-92826846 TAGAAGCATCCCTTGAGTCTAGG + Intergenic
1057681185 9:97187186-97187208 TAGAAGCATCCCTTGAGGCTTGG - Intergenic
1057754269 9:97819293-97819315 TAGAAAAATATCTGGAGGCTGGG + Intergenic
1058222227 9:102316613-102316635 TAGTAGTTTACCTTGAGACTTGG - Intergenic
1058859505 9:109101148-109101170 TAGAAGAGTACTCTGGGTCTAGG + Intronic
1059220283 9:112609642-112609664 TAGGAGAATCCCTTGAGCCTAGG - Intronic
1060243737 9:121926559-121926581 TAGACGAGGATCCTGAGGCTGGG + Intronic
1060248067 9:121963097-121963119 TAGATGAGGACATCGAGGCTTGG - Intronic
1060307415 9:122427490-122427512 TAGATGAGAACCTGGAGACTTGG - Intergenic
1060606861 9:124922456-124922478 TGGAAGAATCCCTTGAGTCTGGG + Intronic
1060856204 9:126915833-126915855 TTGAAGAGTAGTATGAGGCTTGG + Intronic
1060991209 9:127850252-127850274 TAGATGAGAAAATTGAGGCTTGG - Intronic
1061522315 9:131126087-131126109 TAGAGGAGTAAGTTGAGGCTCGG + Intronic
1061611760 9:131751379-131751401 CAGAAAAGTACCTTCTGGCTGGG + Intergenic
1062110633 9:134780318-134780340 AAGAAGAGTAAGTTGAGGATAGG + Intronic
1062755968 9:138290698-138290720 TGGAAGAATAGCTTGAGTCTGGG - Intergenic
1185664977 X:1758354-1758376 TAGGAGAATCCCTTGAGCCTAGG + Intergenic
1187109048 X:16277132-16277154 TGGAAAAATAACTTGAGGCTGGG - Intergenic
1187674289 X:21700483-21700505 TAGAAGAGAATCTGGTGGCTTGG - Intergenic
1187704522 X:21996319-21996341 TTGAAGACTAGCTTGAGGCTGGG + Intergenic
1187908720 X:24090672-24090694 TAGAAGGATCCCTTGAGGCCAGG - Intergenic
1189300749 X:39950519-39950541 TAGATGAGAACACTGAGGCTCGG - Intergenic
1189403906 X:40700261-40700283 TAGAAGAATCGCTTGAGCCTGGG + Intronic
1189497329 X:41520979-41521001 TGGGAGAGTGGCTTGAGGCTAGG - Intronic
1189803888 X:44716528-44716550 TAGAAGAGGATCTCCAGGCTGGG - Intergenic
1189914587 X:45844378-45844400 CAGAAGAATCACTTGAGGCTAGG + Intergenic
1189917858 X:45874684-45874706 TACAAGAGTACCCTGATGTTAGG + Intergenic
1189917861 X:45874716-45874738 TACAAGAGTACCCTGATGTTAGG + Intergenic
1189917866 X:45874780-45874802 TACAAGAGTACCCTGATGTTAGG + Intergenic
1189917869 X:45874812-45874834 TACAAGAGTACCCTGATGTTAGG + Intergenic
1189917872 X:45874844-45874866 TACAAGAGTACCCTGATGTTAGG + Intergenic
1190101389 X:47525075-47525097 TAGAAGAATAAATGGAGGCTGGG - Intergenic
1190140468 X:47838877-47838899 TGGAAGAATCACTTGAGGCTGGG - Intronic
1190190088 X:48269802-48269824 TAGGAGAATCCCTTGAGCCTGGG - Intronic
1190369743 X:49729271-49729293 TAGAAGGATACCTTGAGCCCAGG - Intergenic
1192182482 X:68925021-68925043 TGGAAGGATCCCTTGAGGCTGGG - Intergenic
1193080886 X:77404898-77404920 TAGAAGTGGACCTAGAGTCTTGG - Intergenic
1194521605 X:94925482-94925504 CAGAAGAATAGCTTGAGCCTGGG + Intergenic
1195548094 X:106136263-106136285 TAGAAGAATCACTTGAGGCCAGG + Intergenic
1196346864 X:114672297-114672319 TAGAAGAGTCGCTTGAGCCCAGG + Intronic
1196914365 X:120517038-120517060 TAAAAGATTGCCATGAGGCTGGG + Intergenic
1197958874 X:131982226-131982248 TAGAAAAGAAAATTGAGGCTTGG - Intergenic
1198140384 X:133796878-133796900 TAGGAGATTACCATGAGCCTAGG - Intronic
1201185159 Y:11394452-11394474 TAGAAGTATTGCTTGAGGCTAGG + Intergenic
1201862094 Y:18610123-18610145 TAGGAGGGTACCTTGAGCCCAGG - Intergenic
1201871229 Y:18710257-18710279 TAGGAGGGTACCTTGAGCCCAGG + Intergenic
1202382475 Y:24287517-24287539 TTGAAGAATAGCTTGAGTCTGGG - Intergenic
1202488309 Y:25382608-25382630 TTGAAGAATAGCTTGAGTCTGGG + Intergenic