ID: 1109759542

View in Genome Browser
Species Human (GRCh38)
Location 13:66809266-66809288
Sequence TAGAAGAGTACCTTGAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 543}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109759540_1109759542 -3 Left 1109759540 13:66809246-66809268 CCTTTTAAATACATTTTTAATAG 0: 1
1: 0
2: 13
3: 130
4: 1180
Right 1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 543
1109759537_1109759542 10 Left 1109759537 13:66809233-66809255 CCACCGCGCCAGGCCTTTTAAAT 0: 1
1: 6
2: 47
3: 499
4: 3895
Right 1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 543
1109759538_1109759542 7 Left 1109759538 13:66809236-66809258 CCGCGCCAGGCCTTTTAAATACA 0: 1
1: 0
2: 1
3: 41
4: 325
Right 1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 543
1109759539_1109759542 2 Left 1109759539 13:66809241-66809263 CCAGGCCTTTTAAATACATTTTT 0: 1
1: 2
2: 26
3: 235
4: 1309
Right 1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG 0: 1
1: 0
2: 2
3: 33
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109759542 Original CRISPR TAGAAGAGTACCTTGAGGCT AGG Intronic