ID: 1109761111

View in Genome Browser
Species Human (GRCh38)
Location 13:66830261-66830283
Sequence GTCCAGGTTGAACAGTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109761111_1109761118 22 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761118 13:66830306-66830328 CTGCTTCATTTGGGGCACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1109761111_1109761114 -1 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761114 13:66830283-66830305 CTTGGCTTTCTAAAGTCTAGAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1109761111_1109761115 12 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761115 13:66830296-66830318 AGTCTAGAGGCTGCTTCATTTGG 0: 1
1: 0
2: 1
3: 9
4: 114
1109761111_1109761116 13 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761116 13:66830297-66830319 GTCTAGAGGCTGCTTCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 110
1109761111_1109761117 14 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761117 13:66830298-66830320 TCTAGAGGCTGCTTCATTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109761111 Original CRISPR GTCCAGGTTGAACAGTCATA TGG (reversed) Intronic