ID: 1109761111

View in Genome Browser
Species Human (GRCh38)
Location 13:66830261-66830283
Sequence GTCCAGGTTGAACAGTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109761111_1109761118 22 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761118 13:66830306-66830328 CTGCTTCATTTGGGGCACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1109761111_1109761114 -1 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761114 13:66830283-66830305 CTTGGCTTTCTAAAGTCTAGAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1109761111_1109761115 12 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761115 13:66830296-66830318 AGTCTAGAGGCTGCTTCATTTGG 0: 1
1: 0
2: 1
3: 9
4: 114
1109761111_1109761117 14 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761117 13:66830298-66830320 TCTAGAGGCTGCTTCATTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 131
1109761111_1109761116 13 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761116 13:66830297-66830319 GTCTAGAGGCTGCTTCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109761111 Original CRISPR GTCCAGGTTGAACAGTCATA TGG (reversed) Intronic
906227003 1:44130415-44130437 GTCCAGGTTGAGGATTCAAAAGG - Intronic
908433429 1:64081186-64081208 TTTCAGGCTGAGCAGTCATAGGG + Intronic
913313114 1:117523084-117523106 CTACAAGTTGAACAGTCTTAGGG - Exonic
915104754 1:153526878-153526900 GTCCATGTGGAACTGTCTTACGG + Intergenic
922981186 1:229828305-229828327 GTTCAGGTAGCACAGTCATAGGG - Intergenic
1065634492 10:27716809-27716831 TACCAGGTTGAAAAGTCATGAGG - Intronic
1072223064 10:93344000-93344022 GTTCAAGTTTAACAGCCATAGGG + Intronic
1075401472 10:122164070-122164092 CTCCAGGTTGCACAGGCATTAGG - Intronic
1076113230 10:127877020-127877042 AGCCAGGTTGAACACTGATAGGG - Intergenic
1079492532 11:21005403-21005425 GTCCAGTCTGAACAGCCACAGGG - Intronic
1094226634 12:28053599-28053621 GTCCATGTTGTGTAGTCATAGGG + Intergenic
1094282637 12:28756353-28756375 CTGCAGCTTGAACAGTCATCTGG + Intergenic
1102990949 12:117315618-117315640 ATCCAGGTTGAACAGACTTGTGG - Intronic
1109021920 13:57107625-57107647 GTACAGGTTGAGCAGTCCTTAGG + Intergenic
1109761111 13:66830261-66830283 GTCCAGGTTGAACAGTCATATGG - Intronic
1110167697 13:72463327-72463349 GTCCAGTTTTACCAGACATATGG + Intergenic
1111455087 13:88471805-88471827 GTCCAGCTTCAACAGTCATAAGG + Intergenic
1115291106 14:31773957-31773979 GTCCAGGTAGCCCACTCATATGG - Intronic
1118626485 14:67664015-67664037 TTCCAGGGAGAACAGTCATTTGG - Intronic
1132071589 15:98781846-98781868 TTCCAGGTTTAAGAGTCTTAAGG + Intronic
1137743480 16:50803460-50803482 ATCCTGGTTGCACAGTCACAAGG - Intergenic
1146321001 17:31846331-31846353 TTCCAGGTTAAACAGTCAACAGG - Intergenic
1147139298 17:38452439-38452461 GTCCAGGAGGAAGCGTCATAAGG - Intronic
1148215034 17:45829758-45829780 TTCCAGGATGGACAGTCACAGGG - Intronic
1150257970 17:63764046-63764068 GGCCTGGTTTAACACTCATAGGG - Exonic
1150353699 17:64465598-64465620 GTTAAGGTTGTACAGACATACGG + Intronic
1152189877 17:78881933-78881955 TGCCAGGTTGACCAGCCATATGG - Intronic
1165170567 19:33889030-33889052 GTCTGGGGTGAACAGTCAAAAGG + Intergenic
1168634861 19:57988381-57988403 GCCCAGGTTGAGAAGTCACAGGG - Intronic
929269216 2:39954780-39954802 GTCCAGGTTGCACTGTGTTATGG + Intergenic
940708783 2:157136533-157136555 GTTTAGGTTTAGCAGTCATAAGG + Intergenic
945955673 2:216083707-216083729 TTGCAGGATGAACAGTCAGAAGG + Intronic
1172622095 20:36324696-36324718 GTCAATGTGGAACTGTCATAAGG - Intronic
1173679593 20:44868530-44868552 GTCCACCTCGAACAGTCATAGGG + Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
956874582 3:73449418-73449440 CTCCAGGTTTTACATTCATAGGG + Intronic
964620888 3:158719124-158719146 CTTCAGGTTATACAGTCATATGG - Intronic
966847172 3:184139659-184139681 GTCCATGTTCAGCTGTCATAGGG + Intronic
967943934 3:194787279-194787301 CTCCAGGTTGCACAGTCCCATGG + Intergenic
972700143 4:41486353-41486375 ATCCAGGTGGCACAGTAATAAGG + Intronic
973029812 4:45323572-45323594 TTCCTTGTTGAAGAGTCATATGG - Intergenic
980907983 4:138967573-138967595 GTTCAGGTTGAAAGGTCATTGGG - Intergenic
982867696 4:160538154-160538176 GTCAAGGTAGAAAAGTCAGAGGG - Intergenic
988611802 5:32734067-32734089 CTGCAGGTCGAACAGCCATATGG + Intronic
1024709385 7:51998333-51998355 CTGCAGGTTGATCAGGCATATGG - Intergenic
1026867168 7:73830966-73830988 GGACAGGTTGAGCAGTTATATGG - Exonic
1031125846 7:117772537-117772559 TTCCAGTTTAAACAGTTATAGGG - Intronic
1031365211 7:120892625-120892647 GTCCAGATTAGAGAGTCATAAGG - Intergenic
1034278319 7:149834114-149834136 GTCCAGGTTCACCAGTCATGGGG - Intergenic
1034581146 7:152043640-152043662 GTGCAGCTTGAACAGTCAGTGGG + Intronic
1034642675 7:152616964-152616986 GTCTACATTGAAAAGTCATACGG - Intergenic
1047119081 8:121880195-121880217 GTCCAGACTGAACAATAATAAGG + Intergenic
1047899919 8:129409137-129409159 ACCCAGGGTGAAGAGTCATAAGG + Intergenic
1051234360 9:14982888-14982910 TTTGAGGTTGAACAGTCAGATGG - Intergenic
1056262368 9:84861929-84861951 GGCCAGGATGAACAAGCATAGGG - Intronic
1058642714 9:107102875-107102897 GAACAGGTTGAACATTAATAAGG - Intergenic
1060049267 9:120365797-120365819 ATCCAGTTTCAACAGTGATATGG - Intergenic
1060491425 9:124087997-124088019 TTCCAGGTTGAATGGGCATAGGG + Intergenic
1061522860 9:131131407-131131429 GTCCAGGCTCAATAGACATATGG - Intronic
1195286460 X:103389382-103389404 GTTTATGTTGAAAAGTCATAAGG - Intergenic
1200970788 Y:9150398-9150420 GTGCTGCTTGAACAGTCATGGGG + Intergenic