ID: 1109761114

View in Genome Browser
Species Human (GRCh38)
Location 13:66830283-66830305
Sequence CTTGGCTTTCTAAAGTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109761110_1109761114 0 Left 1109761110 13:66830260-66830282 CCCATATGACTGTTCAACCTGGA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1109761114 13:66830283-66830305 CTTGGCTTTCTAAAGTCTAGAGG 0: 1
1: 0
2: 0
3: 20
4: 207
1109761111_1109761114 -1 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761114 13:66830283-66830305 CTTGGCTTTCTAAAGTCTAGAGG 0: 1
1: 0
2: 0
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109761114 Original CRISPR CTTGGCTTTCTAAAGTCTAG AGG Intronic