ID: 1109761118

View in Genome Browser
Species Human (GRCh38)
Location 13:66830306-66830328
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109761110_1109761118 23 Left 1109761110 13:66830260-66830282 CCCATATGACTGTTCAACCTGGA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1109761118 13:66830306-66830328 CTGCTTCATTTGGGGCACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1109761111_1109761118 22 Left 1109761111 13:66830261-66830283 CCATATGACTGTTCAACCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1109761118 13:66830306-66830328 CTGCTTCATTTGGGGCACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1109761113_1109761118 6 Left 1109761113 13:66830277-66830299 CCTGGACTTGGCTTTCTAAAGTC 0: 1
1: 0
2: 2
3: 13
4: 219
Right 1109761118 13:66830306-66830328 CTGCTTCATTTGGGGCACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type