ID: 1109764412

View in Genome Browser
Species Human (GRCh38)
Location 13:66874968-66874990
Sequence AGAGATATGTAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 440}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109764412 Original CRISPR AGAGATATGTAGAAGGGGGA GGG Intronic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
901849633 1:12007303-12007325 AGAGAGATGGGGAAGGGAGATGG - Intronic
902654776 1:17859658-17859680 AGAGAGATGGGTAAGGGGGAGGG + Intergenic
902711634 1:18243921-18243943 ACAGATATGGAGAATGGGGGAGG - Intronic
903572217 1:24314383-24314405 AGGGATAGATAGAAGGGAGATGG - Intergenic
904421304 1:30396147-30396169 ACAGATATATGGATGGGGGAAGG + Intergenic
904935305 1:34125959-34125981 AGTGATATTCAGAAGGGAGAGGG + Intronic
905429120 1:37908847-37908869 AGAGACATGGAGAAGTGGGTGGG - Intronic
905522075 1:38608097-38608119 AGAAATTGGTAGAAGGGGAAGGG + Intergenic
906119727 1:43381235-43381257 AGAGAGATGTGTGAGGGGGAGGG + Intergenic
907181286 1:52572641-52572663 AGAGAGAGGGAGAAGGGAGAGGG - Intergenic
907192836 1:52663130-52663152 AGAGAGATGGAGAAGAGGGAGGG - Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
909307729 1:74102605-74102627 ATAAATATCTAGAAGTGGGATGG - Intronic
909332618 1:74432431-74432453 AGAGAGAAATAGAAGGGTGACGG - Intronic
909395530 1:75167463-75167485 AGAGAAATGGAGAAAGGAGAGGG - Intergenic
909793130 1:79700837-79700859 AGAGACATGGAGAAGGGGTGGGG + Intergenic
909795186 1:79726420-79726442 AAAAATATGTGGAAGGAGGATGG + Intergenic
910555513 1:88527834-88527856 AGAGATATGTTGAGGCAGGAAGG + Intergenic
912999112 1:114562150-114562172 AGAGGGAGGTAGAAGGTGGAAGG - Intergenic
914428835 1:147601140-147601162 AGAGGTCTGAAGGAGGGGGAAGG + Intronic
915461283 1:156072070-156072092 AGAGAAACCAAGAAGGGGGAGGG - Exonic
915521091 1:156444490-156444512 AGACAGATATAGAAGGGGAAAGG + Intergenic
917749484 1:178041154-178041176 AGAGACATGGAGAAGGGAGTAGG - Intergenic
918127853 1:181600108-181600130 AGAAATCTGCAGAAGTGGGAGGG + Intronic
918215206 1:182387374-182387396 AGAGATATTTAGAGATGGGAAGG - Intronic
918567831 1:185952812-185952834 AGAGACACGGAGAAGGGGTAGGG + Intronic
918771173 1:188562222-188562244 AGACATCTGAAGAAGGTGGAAGG + Intergenic
919284441 1:195537032-195537054 AGAGAAATATAGTAGGGAGACGG - Intergenic
919907509 1:202087993-202088015 TGAGAAATGAAGAAGAGGGAGGG + Intergenic
921502674 1:215924953-215924975 TGAGCTATGGAGAAGAGGGAAGG - Intronic
922401659 1:225264747-225264769 AGATAGCTGTAGAAAGGGGAAGG + Intronic
922466161 1:225846620-225846642 AGAGAGATGTAACAAGGGGAAGG - Exonic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
1062782577 10:228736-228758 AGTGTTATGTAGAAGGGGAAAGG + Intronic
1062945296 10:1456698-1456720 AGAAATATGTTTAAGGGGAAAGG - Intronic
1064663972 10:17631323-17631345 AGAGACATGGAGAAGGGGTGGGG + Intergenic
1065610367 10:27466290-27466312 AGAGACATGGAAAAGGGGGTGGG - Intergenic
1065642891 10:27803379-27803401 AGAGATGTGTATATGGGGGAGGG - Intergenic
1066437521 10:35407775-35407797 AGAGACACGGAGAAGGGGGGTGG + Intronic
1067009831 10:42700591-42700613 GCAGATAGGTAGAAGAGGGAGGG + Intergenic
1067313893 10:45142709-45142731 ACAGACAGGTAGAAGAGGGAGGG - Intergenic
1067551797 10:47241580-47241602 AGAGACATGGAGTCGGGGGAAGG + Intergenic
1068606412 10:59009972-59009994 AGAGATATGGGGAAGAGGGAAGG + Intergenic
1068613395 10:59085733-59085755 TGAGAAGTGTAGAAGGAGGAAGG + Intergenic
1069071474 10:63994381-63994403 AGAGAAATGTGGAAGGGGCCTGG + Intergenic
1069548440 10:69345490-69345512 AGAGCTATGTAGCAGAGGCATGG + Intronic
1070555768 10:77526857-77526879 GGAGATATGGAGAGGGAGGATGG - Intronic
1071711199 10:88051346-88051368 AGAGTTATGAAGAAGGGTGGTGG + Intergenic
1072468801 10:95693061-95693083 AGATATATTTAGAAGGGGCGGGG + Intronic
1075125213 10:119693961-119693983 AGAAGAAGGTAGAAGGGGGATGG - Intergenic
1075194577 10:120344388-120344410 AGAGATAGTGAGAAGGGGGGTGG + Intergenic
1075317561 10:121465142-121465164 TGAGTTATGTAGAAGGAGGGTGG - Intergenic
1076517286 10:131053793-131053815 AGGGATATCTAGAAGAGGGAGGG - Intergenic
1078512125 11:11992723-11992745 AGAAATATAAACAAGGGGGATGG - Intronic
1079339402 11:19599550-19599572 AGAGAAGTGTGGAAGGGGTAGGG + Intronic
1079638262 11:22772724-22772746 AGAGATGAGTAGAAGGAGGGAGG + Intronic
1080970701 11:37272301-37272323 AGATATGTGTGGGAGGGGGATGG + Intergenic
1081571462 11:44294012-44294034 AGAGCTCTGTAGACGGTGGAGGG - Intronic
1082138628 11:48580056-48580078 TGAGATTAGTAGAAGGGTGAAGG - Intergenic
1082849422 11:57752555-57752577 AGAGAGATGTGGATGGAGGATGG + Intronic
1082971859 11:59031198-59031220 AGAGACAAGTGGAAGGGGAAGGG - Intronic
1083887146 11:65578433-65578455 AGAGATGAGTGGCAGGGGGATGG - Intronic
1084051673 11:66604279-66604301 AGAAAGATCAAGAAGGGGGAGGG - Intronic
1084290362 11:68161629-68161651 AGAGAAATGAAGAAAGGGAAGGG - Intronic
1084499742 11:69528390-69528412 AGAGCTATGTATAAAGGGGTGGG + Intergenic
1085127477 11:74011424-74011446 AGAGATAAATAGAAGCGGGAGGG + Intergenic
1085492380 11:76933019-76933041 AGAGATAAGTAGAAAGGGGGAGG + Intronic
1085744113 11:79100261-79100283 AGTGATGTGTAGGAGGGGGCGGG - Intronic
1085820126 11:79783429-79783451 TGAGTAATGTAGAAGAGGGAAGG - Intergenic
1085934103 11:81123015-81123037 AGAGACACGGAGAAGGGGGTGGG - Intergenic
1086004861 11:82026384-82026406 AGAGACATGGAGAAGGGTGTGGG - Intergenic
1086125460 11:83344618-83344640 AGAGACACGGAGAAGGGGGTGGG + Intergenic
1087274743 11:96149837-96149859 AGAGAAATTTAGAAGAGAGAAGG - Intronic
1088927688 11:114319067-114319089 AGAGGTTTCTAGAAAGGGGAGGG + Intergenic
1089035851 11:115390350-115390372 AGAGAGAGGGAGAAGGGGAAAGG + Intronic
1089141468 11:116288294-116288316 AGAGATTTGGAGTTGGGGGAAGG + Intergenic
1089348948 11:117810497-117810519 AGAGATACGGAGAAGGGGGTGGG - Intronic
1090107755 11:123870119-123870141 AGAGACACGGAGAAGGGGGTGGG + Intergenic
1092454442 12:8630171-8630193 AGAAATATGGAGCAGGAGGATGG - Intergenic
1092789565 12:12059613-12059635 AGAGACACGGAGAAGGGGTAGGG - Intronic
1092964299 12:13626828-13626850 AGAGCTATGGTGAGGGGGGAGGG - Intronic
1093578663 12:20764594-20764616 AGAGACATGGAGAAGGGGTGGGG - Intergenic
1094128282 12:27046672-27046694 ATAAATATGTAGAAGTGGAATGG + Intronic
1094138237 12:27151975-27151997 AGAGCTATTTAGAAGATGGAAGG - Intergenic
1094772760 12:33684505-33684527 AGAAATATGAAGAAGGAAGAAGG - Intergenic
1095503886 12:42871306-42871328 ACATATATGTGAAAGGGGGAGGG - Intergenic
1095611650 12:44135493-44135515 AGTGATATGGGGAAGGGAGAAGG - Intronic
1095637505 12:44450989-44451011 AGAGACACGGAGAAGGGGGTGGG - Intergenic
1095999244 12:48115017-48115039 AGAGTCATGGAGAAGGGGGATGG + Intronic
1096046040 12:48563265-48563287 AGACATAAGTAAAAGGGAGAGGG - Intergenic
1096502667 12:52074359-52074381 AGAAAGATGTAGAAGGGACACGG + Intronic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1097398434 12:59103054-59103076 AGAGACATGGAGAAGGGGTAGGG - Intergenic
1098213037 12:68186259-68186281 AGAGAGATGTGGAAGGGGCTGGG + Intergenic
1098402093 12:70086615-70086637 AGAGATACGGAGAATGGGGGCGG - Intergenic
1098566699 12:71945307-71945329 AAACAGATGTAAAAGGGGGAAGG - Intronic
1098630186 12:72713402-72713424 AGAGACAGGGAGAAGGGGGTGGG + Intergenic
1099171740 12:79372802-79372824 AGAGATAAGAAGAGAGGGGAGGG - Intronic
1099205191 12:79718926-79718948 AGAGAAATGAAGCAGGGTGAAGG + Intergenic
1101346979 12:103894888-103894910 AGAGCTCTTTAGAAGGAGGAAGG - Intergenic
1101676503 12:106921803-106921825 AGTGATGTGTACATGGGGGAAGG - Intergenic
1102392757 12:112562900-112562922 AGGGATAGGGAGAAGTGGGAAGG - Intergenic
1102717385 12:114986193-114986215 AGAGGAAGGTAGGAGGGGGAAGG - Intergenic
1106107249 13:26743248-26743270 AGAGAGATGGAGAAGGGGGCTGG + Intergenic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1106260829 13:28065213-28065235 AGGGATATGTAGAAAGAGGGTGG + Intronic
1108067190 13:46590275-46590297 AGAGATAGGGTGAAGGGGGGAGG - Intronic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109130309 13:58575965-58575987 AGAGAGACAGAGAAGGGGGAAGG + Intergenic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1110467192 13:75815325-75815347 AGATATATTTAGAAGGCAGAGGG + Intronic
1111292692 13:86188413-86188435 AGTGATATGGAAAAGGGGGAAGG + Intergenic
1115886012 14:37972169-37972191 AGAGCTATGTAGCATGGGGAGGG - Intronic
1116702559 14:48259909-48259931 AGAGACATGGAGAAGGGGTGGGG + Intergenic
1116703442 14:48266884-48266906 AGAGACATGGAGAAGGGGTGGGG + Intergenic
1116952761 14:50894387-50894409 AGAGACATGGAGAAGGGGTGGGG - Intronic
1116991738 14:51284522-51284544 AGAGATAAGTAAAAGGAGGCAGG - Intergenic
1118879196 14:69811700-69811722 AGAGATAGTGAGAAGGGGGGTGG - Intergenic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119501108 14:75127847-75127869 GGAGTTGTGTAGAAGAGGGAGGG - Intergenic
1119819457 14:77602072-77602094 AGAGACACGGAGAAGGGGGTTGG - Intronic
1120168041 14:81220954-81220976 AGAGACAGGGTGAAGGGGGAGGG + Intronic
1120205936 14:81587820-81587842 CGAATTATGTAGAAGGAGGAGGG - Intergenic
1120618102 14:86732524-86732546 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1120930056 14:89839343-89839365 AGAGCAAAGTAGAATGGGGATGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121193470 14:92049252-92049274 AGAGACACGGAGAAGGGGGTGGG + Exonic
1121417823 14:93791042-93791064 AGAGATAGTGAGAAAGGGGAGGG + Intergenic
1121741769 14:96257738-96257760 AGAGATAGCTAGGAGAGGGATGG + Intronic
1121951600 14:98175596-98175618 AGAGACATGTAGAAGGAAGCAGG - Intergenic
1121980737 14:98451667-98451689 AGAGACACGGAGAAGGGGGTGGG + Intergenic
1122219097 14:100224053-100224075 AGATATATGCAGAAGGGTGGTGG + Intergenic
1122681104 14:103463886-103463908 AGAGATGTGTAGAGGGGGCTGGG - Intronic
1123062865 14:105602078-105602100 AGAGAGAGTTTGAAGGGGGAGGG - Intergenic
1125177934 15:36846931-36846953 AGAGAAATCAAGAAGGAGGATGG - Intergenic
1125213378 15:37240731-37240753 AGAGATACGGAGAAGGGGGTGGG + Intergenic
1125520167 15:40343998-40344020 GGAGATGTGTAGATGGGGTAAGG + Intergenic
1125741132 15:41965799-41965821 GGAGAAATGTAGGAGGGGGAAGG - Intronic
1125885069 15:43223025-43223047 AAAGATATGCAGATGGGGCACGG + Intergenic
1126196478 15:45937272-45937294 GGGGATATGCAGAAGGGTGATGG - Intergenic
1126666322 15:51078658-51078680 AGAGAAATGTTGAATGTGGAGGG - Intronic
1126860424 15:52877573-52877595 AGAGAGATGGAGGAAGGGGAGGG - Intergenic
1126912552 15:53431331-53431353 AGAGACACGGAGAAGGGGTAGGG + Intergenic
1128061767 15:64739805-64739827 AGAGATGTGGAGTCGGGGGAAGG - Intergenic
1128538511 15:68508655-68508677 AGGGAAATTTAGAAGGGAGAAGG - Intergenic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1129697324 15:77748050-77748072 AGAGTTGTGTGGAAGGGGAAAGG - Intronic
1130167597 15:81479516-81479538 AGAGATATGGGGCCGGGGGAGGG + Intergenic
1131291714 15:91112147-91112169 GGGGATAGGGAGAAGGGGGATGG + Intronic
1132868249 16:2104292-2104314 AGAGAGATGGAGAAAAGGGATGG + Intronic
1133893735 16:9905740-9905762 AAAAATATATACAAGGGGGAGGG + Intronic
1134449249 16:14353824-14353846 GGAGAGTAGTAGAAGGGGGAGGG + Intergenic
1134523517 16:14928805-14928827 AGAGAGATGGAGAAAAGGGATGG - Intronic
1134549375 16:15132115-15132137 AGAGAGATGGAGAAAAGGGATGG + Intronic
1134711111 16:16327289-16327311 AGAGAGATGGAGAAAAGGGATGG - Intergenic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134948463 16:18341294-18341316 AGAGAGATGGAGAAAAGGGATGG + Intergenic
1134955721 16:18381404-18381426 AGAGAGATGGAGAAAAGGGAGGG + Intergenic
1135531360 16:23257654-23257676 AGAGAAGTGGAGAAGGGGAATGG + Intergenic
1135628993 16:24021370-24021392 AGAGAGATGGAGGAGGGGGGAGG - Intronic
1136120026 16:28126904-28126926 AGAGAACTGAAGTAGGGGGAGGG - Intronic
1137465261 16:48702703-48702725 AGAGAGAGAAAGAAGGGGGAGGG - Intergenic
1140314370 16:73880252-73880274 AGAGAGGTTTAGATGGGGGATGG + Intergenic
1140989368 16:80193690-80193712 AGAGTAATGAAGAAGGGGGCAGG - Intergenic
1141199418 16:81885520-81885542 AAAGAAATGAAGAAAGGGGAAGG - Intronic
1141487412 16:84349912-84349934 AGAGATTTGAAGATGGAGGAAGG + Intergenic
1141620598 16:85235043-85235065 AGACATCTGTAGATGGGGGCGGG + Intergenic
1141865374 16:86746533-86746555 AGAGACACGGAGAAGGGGTAGGG + Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1146499423 17:33351829-33351851 AGAGACATGTAGATGTGGCATGG + Intronic
1146592102 17:34136327-34136349 GAAGATATGTGGAAGGGGAAAGG - Intronic
1146826042 17:36023961-36023983 AGAGATAGTGAGAAGGGGGTTGG + Intergenic
1148144046 17:45349804-45349826 AGAGATTGGGAGAAGGGTGAGGG + Intergenic
1148725389 17:49786072-49786094 AGGTATATTTAGAATGGGGAAGG - Intronic
1148966165 17:51437862-51437884 AGGGAGATGGAGAAGGGGAAAGG + Intergenic
1149102319 17:52921840-52921862 ACAGATATATTGAAGGGTGAGGG + Intergenic
1149319354 17:55468667-55468689 AGAGACACGGAGAAGGGGGCGGG - Intergenic
1149453725 17:56770477-56770499 ATAGATGAGTGGAAGGGGGATGG - Intergenic
1151537268 17:74745962-74745984 AGAGATATGGAGATGGGAGGGGG + Exonic
1152272485 17:79333049-79333071 AGAGACATAGAGAAAGGGGAGGG + Intronic
1153540585 18:6149840-6149862 AGAGAAAGAGAGAAGGGGGATGG - Intronic
1153718166 18:7872313-7872335 AGTGATATGAGGAAGTGGGAAGG - Intronic
1155806464 18:30176180-30176202 AGAGAGAGGTGGAAGGGGCACGG + Intergenic
1155961790 18:32001452-32001474 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1156252091 18:35360835-35360857 AGAGACACGGAGAAGGGGGTGGG + Intergenic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1156332906 18:36141579-36141601 AGAGAAATTTAGAAAGGGGTTGG + Intronic
1156854128 18:41762447-41762469 AGAGAGATGGCGGAGGGGGAGGG - Intergenic
1156985057 18:43341307-43341329 GGAGAGAGGGAGAAGGGGGAAGG + Intergenic
1157479437 18:48044150-48044172 AGAGAAATGCAGAAGTGGAATGG - Intronic
1157928424 18:51791660-51791682 AGTGATATGTGGACTGGGGATGG - Intergenic
1158336227 18:56416808-56416830 AGAGACACGGAGAAGGGGTAGGG - Intergenic
1158529757 18:58248533-58248555 ACAGATTTGTAGCAGGGAGAGGG + Intronic
1158576862 18:58645500-58645522 AGAGATACGGAGAAGGGGGATGG + Intergenic
1158776246 18:60583491-60583513 AGAGATCTGAAGCAGGTGGATGG - Intergenic
1158794381 18:60825274-60825296 AGAGATATGTAGAAAATAGAAGG + Intergenic
1158951516 18:62499578-62499600 AGAGGAAGGAAGAAGGGGGAAGG - Intergenic
1159834895 18:73325852-73325874 AGAGACACGGAGAAGGGGTAGGG - Intergenic
1160681819 19:415181-415203 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160681860 19:415434-415456 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160951567 19:1670013-1670035 AGAGAGAGAGAGAAGGGGGAGGG - Intergenic
1163177015 19:15571508-15571530 ATAGATATGTAGATGATGGATGG - Intergenic
1163674709 19:18649765-18649787 AGAGACATGTGGAAGGGGCGGGG - Intronic
1164053227 19:21600672-21600694 AAAGAAAGGTAGGAGGGGGAGGG - Intergenic
1164072987 19:21786293-21786315 AGAGATAGTGAGAAGGGGGATGG + Intergenic
1164258604 19:23550442-23550464 AGAGATGTGGAGAAGGGTGTGGG - Intronic
1164511143 19:28898254-28898276 AGAGGTATGAAGATGGGTGAAGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1164997277 19:32731130-32731152 AGAGAAATGGAGAAGGGACACGG - Intronic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165835202 19:38750806-38750828 AGAGACATGGAGAAGGGGTGGGG - Intronic
1165883692 19:39061872-39061894 AGAGATCTGTAGCATGGGGTAGG - Intergenic
1166158988 19:40937571-40937593 AGAGATATATAGACTGGGCATGG + Intergenic
1166499090 19:43327983-43328005 AGAGACATGGAGAAGGGGTGGGG + Intergenic
1166917036 19:46202505-46202527 AGAGACATGGAGAGGGGGGTTGG + Intergenic
925422451 2:3723940-3723962 AGAGAGACAGAGAAGGGGGAAGG - Intronic
926536648 2:14121623-14121645 AGACATATATAGAAGGGGTTTGG - Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
928899640 2:36303406-36303428 AGCGAAATGAAGTAGGGGGAGGG + Intergenic
929624546 2:43393141-43393163 AGAGATGAGTAGAGAGGGGAGGG + Intronic
929684695 2:44023575-44023597 AGAGACACGGAGAAGGGGGGTGG + Intergenic
929813956 2:45216122-45216144 AGAGATCTGTAGGAGGTGGGTGG - Intergenic
929922441 2:46182259-46182281 AGATCTCTGTGGAAGGGGGAGGG - Intronic
930966334 2:57332996-57333018 AAAGATATGTAGAAGGGGTAGGG - Intergenic
931625623 2:64253749-64253771 AGAGACATGGAGAAGGGGTGGGG - Intergenic
931850270 2:66245150-66245172 AGAGACATGGAGAAGGGGTGGGG - Intergenic
932346271 2:70997457-70997479 AGAGATATGTATATGGGGCATGG + Intergenic
934683661 2:96305144-96305166 AGTGACGTGTGGAAGGGGGAGGG + Intronic
935660224 2:105460471-105460493 AGAAAAATGTAGGAGGGAGAGGG + Intergenic
935672007 2:105563860-105563882 AGAGAGATATAGAATGTGGAGGG - Intergenic
936342165 2:111643304-111643326 AGAGAAAATTAGAAGGAGGAAGG - Intergenic
936580585 2:113697085-113697107 AGAGTTATATAGAAGGTAGATGG - Intergenic
937013128 2:118579592-118579614 AGAGTTTGGTTGAAGGGGGATGG + Intergenic
937110584 2:119364064-119364086 AGAGATAGGAGAAAGGGGGAGGG + Intronic
937202354 2:120212241-120212263 TGAGATTTGTAGGAGGGTGAAGG - Intergenic
938601343 2:132843998-132844020 AGAGATTTCTGGAAGGGGAAAGG - Intronic
939009832 2:136832981-136833003 AGAGATCAGTAGAAGAGTGATGG - Intronic
939918536 2:148079528-148079550 AGACACAAGTAGAAGTGGGATGG - Intronic
941420646 2:165279734-165279756 AGAGATTAGTGGAAGGAGGAGGG + Intronic
941462177 2:165784413-165784435 AGAGATAAATATAAGGGGCATGG + Intronic
942345001 2:174993505-174993527 ACAGACATGTAGAAAGTGGAAGG + Intronic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
942962146 2:181843670-181843692 ATGGATATGTAGAAGAGGGAGGG + Intergenic
943132580 2:183872967-183872989 AAAATTATGTAGAAGGAGGAAGG - Intergenic
943661162 2:190561061-190561083 AGAGATATGGAGCAGTGGGAAGG + Intergenic
943761678 2:191616873-191616895 AGAGATATTAAAAAGTGGGAGGG + Intergenic
944417890 2:199497052-199497074 AGAGGTATGGAGATGGGGGATGG + Intergenic
946326266 2:218985992-218986014 AGAGAGACCTAGAAGGGGGCGGG - Intergenic
946998356 2:225422209-225422231 AGAGAGATCGGGAAGGGGGAAGG + Intronic
947597360 2:231421523-231421545 AGGGAGATGTAGAAGGGGATGGG - Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948456966 2:238109071-238109093 AGAGATAGGAAGTGGGGGGAGGG + Intronic
1169453459 20:5731901-5731923 AGAGATATGTGGCAGTAGGAGGG + Intergenic
1169541089 20:6600496-6600518 AGAGAAAAGCAGAAGGGGGTAGG + Intergenic
1170820861 20:19755621-19755643 AGAGACATGGAGAAGGGGTGGGG + Intergenic
1172152967 20:32803577-32803599 AGTGACATGCCGAAGGGGGAGGG + Intronic
1172598847 20:36169632-36169654 AGAGATGGGAAGAAGGGGGTTGG - Intronic
1173651813 20:44671175-44671197 AGAGATATGGAGAAGGGGGTGGG - Intergenic
1174175119 20:48639758-48639780 AGAGATATGTGGAAGGTCGGTGG - Exonic
1175570354 20:60014311-60014333 TTAGATAGCTAGAAGGGGGATGG - Intronic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1178001038 21:28162366-28162388 AGAGACACGGAGAAGGGGGTGGG - Intergenic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1178839624 21:36128429-36128451 AGAGATTTGGAGATGGAGGAAGG - Intergenic
1181149778 22:20874986-20875008 AGAGGTATGTAGGATGTGGAAGG - Intronic
1181574685 22:23786434-23786456 AGAGGAATGGAGAAGGTGGAAGG + Intergenic
1184106282 22:42369177-42369199 AGAGAAAGGGAGAAGGGGGTGGG - Intergenic
1184447302 22:44556421-44556443 AGAGAAATGAAGCTGGGGGATGG - Intergenic
950105621 3:10386494-10386516 ACAGGTGTGAAGAAGGGGGATGG - Exonic
950168242 3:10817305-10817327 ATAGAGATGTAGAAGGGGAGAGG + Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950198797 3:11028417-11028439 AGAGATATGTAGGGGATGGAGGG - Intronic
950623852 3:14230038-14230060 AGAGATAGTGAGAAGGGGGGTGG - Intergenic
950739815 3:15041296-15041318 AGAGATACAAAGAATGGGGAGGG - Intronic
951096555 3:18638447-18638469 GGAAATAGGTAGAAGGGGTATGG + Intergenic
951894707 3:27599911-27599933 AGAGACACGGAGAAGGGGGGTGG - Intergenic
952296657 3:32068411-32068433 AGAGACACGGAGAAGGGGGGTGG - Intronic
952874496 3:37932564-37932586 AAAGAGATGTAGAACTGGGATGG + Intronic
953833816 3:46326191-46326213 AAAGATAGTGAGAAGGGGGATGG - Intergenic
953841354 3:46392458-46392480 AGAGACATGGAGAAGGGGGGAGG + Intergenic
956153723 3:66271461-66271483 AGAACTATGAAGAAGGGGAAGGG + Intronic
956161026 3:66352773-66352795 AGAGGTATGGGGAAGGGGGATGG - Intronic
957900833 3:86487611-86487633 TTAGAGATGTAGAAGGGGGCAGG - Intergenic
958421794 3:93938948-93938970 AGAGACATGGAGAAGGGGGGTGG - Intronic
958750840 3:98192147-98192169 AGACATAGGGAGAAGGGGTAGGG - Intronic
959117476 3:102195103-102195125 AGAAATATTTACATGGGGGATGG + Intronic
959246166 3:103871700-103871722 AAAGATATGTTGAAAGGGGAAGG + Intergenic
959794917 3:110414826-110414848 AAAGATTTGAAGAAGGGGAAGGG + Intergenic
960337686 3:116437934-116437956 ATAGATATGTAGAATAGGAAAGG - Intronic
961180585 3:124873427-124873449 AGAGGTATGTAGGTGGGGGAGGG - Exonic
961490336 3:127252909-127252931 GGAGATATGTAGGAGGGTGCAGG + Intergenic
961711779 3:128833696-128833718 AGAGACACGGAGAAGGGGTAGGG + Intergenic
961848186 3:129786597-129786619 ATATATATTTAGAAGAGGGAAGG - Intronic
963003522 3:140705200-140705222 TGAGATTTGCAGCAGGGGGAGGG - Intergenic
963319575 3:143798450-143798472 AGAGACATGGAGAAGGGTGTGGG - Intronic
963456842 3:145555754-145555776 AGAGATATGAAGTTGGGGCATGG + Intergenic
963520282 3:146354747-146354769 AGAGACATGGAGAAGGGGGTGGG - Intergenic
964159253 3:153626805-153626827 GCACATTTGTAGAAGGGGGATGG + Intergenic
964985032 3:162727043-162727065 AGAGACATGGAGAAGGGGTGGGG + Intergenic
965948261 3:174269334-174269356 AGAGCTGTGGAGAAAGGGGAAGG - Intronic
966979062 3:185113761-185113783 AGAGCTATGTGGAACAGGGAAGG + Intronic
967210187 3:187161684-187161706 AGAGACTTGGGGAAGGGGGAGGG - Intronic
967625228 3:191674980-191675002 AGAGATATGTAGAAAATGTAAGG - Intergenic
967643989 3:191899903-191899925 AGAGACATGGAGAAGGGGTAGGG + Intergenic
969141152 4:5074072-5074094 AGAGACAAATAAAAGGGGGAGGG - Intronic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
971128809 4:23783076-23783098 AGAGGTATGTGGGAGTGGGAAGG + Intronic
971251264 4:24975321-24975343 AGACAAAAGGAGAAGGGGGAAGG + Intronic
971330620 4:25678230-25678252 ATTGATATCTACAAGGGGGAGGG - Exonic
972787977 4:42345333-42345355 AGAGATTTGCACAAGGGGGTGGG + Intergenic
974199301 4:58618487-58618509 AGTGGTAAGTAGAAGAGGGATGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975565583 4:75750771-75750793 AGAAAAATGTAGAATGGGCACGG - Intronic
975737947 4:77399928-77399950 GGAGATAGGGAGAAGGGGGGTGG + Intronic
976325697 4:83769348-83769370 AGAAATACACAGAAGGGGGAAGG - Intergenic
976688211 4:87839476-87839498 AGAGTTATGTAGAAAAGAGAAGG + Intronic
977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG + Intronic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
979798487 4:124876707-124876729 AGAGACACGGAGAAGGGGCAGGG + Intergenic
982084116 4:151817099-151817121 AGAGACATGGAGAAGGGGTAGGG + Intergenic
982946873 4:161635660-161635682 AGAAATAAGTAAAAGAGGGATGG + Intronic
983452179 4:167924098-167924120 AGAGACACGGAGAAGGGGTAGGG - Intergenic
983575480 4:169256770-169256792 AAAAAAATTTAGAAGGGGGATGG + Intronic
984138431 4:175971535-175971557 AGAGATATAAAGGAGAGGGAGGG - Intronic
985199041 4:187465115-187465137 AGAGATATTGAGAAGAGAGATGG - Intergenic
987487348 5:18539522-18539544 AGAGACATGGAGAAGGGGTGGGG - Intergenic
987498285 5:18673355-18673377 AGAGACATGGAGAAGGGGTGGGG + Intergenic
988529734 5:32017024-32017046 ACAGATGTGCAGATGGGGGATGG + Intronic
988655712 5:33209562-33209584 AGAGATAGCAAGAAGGGGGGTGG - Intergenic
988926115 5:35992411-35992433 AGAGAAGTGTGGAGGGGGGAAGG + Intergenic
990018665 5:51098686-51098708 AGAGATATAAAGAAATGGGAAGG + Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990700338 5:58468012-58468034 ACAGATATGTGGAAAAGGGATGG + Intergenic
990867421 5:60395803-60395825 AGAGAGATGCAGAGCGGGGAGGG - Intronic
992850154 5:80798804-80798826 AGAGATAAGAAGAGAGGGGAGGG - Intronic
993050846 5:82924137-82924159 AAATATGTGTTGAAGGGGGAGGG - Intergenic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
993810548 5:92470731-92470753 GGAGGTATGGAGAAGGGGCATGG + Intergenic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994364883 5:98902189-98902211 AGAGATTTGTAGAAAGAGAAAGG + Intronic
995269297 5:110203213-110203235 AGAGAAATGTAGAGGAGGAAAGG - Intergenic
995563263 5:113405991-113406013 ATAATTATTTAGAAGGGGGATGG - Intronic
995758414 5:115537733-115537755 AGAGAAAAATAAAAGGGGGAAGG - Intronic
995900182 5:117056447-117056469 AGAGGGAAGTAGAGGGGGGAAGG + Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997864069 5:137445161-137445183 GGAAATATAGAGAAGGGGGAGGG - Intronic
997882284 5:137601736-137601758 AGAGATAGGTGGAGAGGGGAAGG - Intergenic
998693869 5:144615948-144615970 AGAGACACGGAGAAGGGGGTGGG + Intergenic
999619023 5:153454207-153454229 AGAGACATGGAGAAGGGGTGGGG + Intergenic
999827308 5:155286168-155286190 AGAGAATGGAAGAAGGGGGAGGG - Intergenic
999910389 5:156191578-156191600 GGAAATAAGTAGTAGGGGGAAGG - Intronic
1000727016 5:164784380-164784402 AGAGAAAGGGGGAAGGGGGAAGG + Intergenic
1001911045 5:175518026-175518048 AGAGATAAGGCGTAGGGGGATGG - Intronic
1002558102 5:180060047-180060069 AGAGACTTGAAGATGGGGGAAGG + Intronic
1002844100 6:931088-931110 AGTGATATGCAGAAGAGAGAAGG + Intergenic
1003138239 6:3449790-3449812 AGAAATTTTTAGAAGTGGGAGGG - Intronic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003841289 6:10123116-10123138 ACAGATATTAAGAAGGGTGAAGG + Intronic
1003995949 6:11538719-11538741 CGATGTGTGTAGAAGGGGGAGGG - Intronic
1004226532 6:13789811-13789833 AAAGAGATGGAGAAGAGGGAGGG + Exonic
1004228049 6:13805316-13805338 AGAGAAAAGTAGAAGCGAGAAGG - Intronic
1004995974 6:21193510-21193532 AGAGGTTGGTAGAAGTGGGACGG - Intronic
1005005283 6:21281742-21281764 AGCTATCTGTAAAAGGGGGAGGG - Intergenic
1005294986 6:24416830-24416852 AGAGAAATTTACATGGGGGAGGG + Intronic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007944901 6:45817386-45817408 AGAGGTATAGAGAAGAGGGAGGG + Intergenic
1008337960 6:50329017-50329039 AGAGATATGCATATTGGGGATGG - Intergenic
1010716611 6:79237528-79237550 AGAGAGAGGGAGAAGGGAGAAGG + Intergenic
1011763665 6:90595228-90595250 AGTGATATTTAAAGGGGGGAGGG - Intergenic
1013004495 6:106059490-106059512 AGAGATAGGTAGAACATGGAAGG + Intergenic
1013697761 6:112724391-112724413 AGAGAAATGTAGAAAGGGTGTGG + Intergenic
1013808296 6:114017210-114017232 AGAGACATGGAGAAGAGGGGTGG + Intergenic
1013843874 6:114426994-114427016 AGAGATATGAGGTAGGGGCACGG + Intergenic
1014115506 6:117664229-117664251 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1014761306 6:125359741-125359763 AGAGAGAGGGAGAAGAGGGAGGG + Intergenic
1014891391 6:126849965-126849987 AGAGACATGGAGAAGGGGTGGGG - Intergenic
1016045275 6:139474478-139474500 TGAGAGCTTTAGAAGGGGGAAGG - Intergenic
1016269730 6:142274610-142274632 AGAGATTTGGGGAAGGGAGAAGG + Intergenic
1016271456 6:142294985-142295007 AGAGACATATAGAAAGGAGAAGG - Intergenic
1016607225 6:145944242-145944264 GGACATATGTAGAAAAGGGAAGG - Intronic
1018102826 6:160456547-160456569 AGAAATGTGCAGAAGGGGGTGGG + Intergenic
1018408134 6:163509431-163509453 AAAGAAATTAAGAAGGGGGAAGG - Intronic
1020794041 7:12660758-12660780 AGAGACATGGAGAAGGGGGGTGG - Intergenic
1021660452 7:22914314-22914336 AGAGACACGGAGAAGGGGGGTGG - Intergenic
1021805891 7:24354540-24354562 AGAGATAGCCAGAAGGGGGGTGG + Intergenic
1022056632 7:26742394-26742416 AGAGATGGGAAGAAGGGAGAGGG + Intronic
1022337224 7:29433320-29433342 AAAGATGTGTAGAACTGGGAAGG + Intronic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024236254 7:47401450-47401472 AGAGATACAAAGAAGGAGGAAGG + Intronic
1026101459 7:67387872-67387894 AGAGATATCAAGAGAGGGGAGGG + Intergenic
1026328803 7:69334340-69334362 AGAGATAGGTAGGAGGAGGGTGG + Intergenic
1026337435 7:69406678-69406700 ACAGATATGTAGGAGGGGAATGG - Intergenic
1027158067 7:75782459-75782481 AGAGACATGGAGAAGGGGGGTGG - Intronic
1027623307 7:80519338-80519360 AGAGGTAAGGAGCAGGGGGATGG + Intronic
1028670353 7:93395134-93395156 AGAGACATGGAGAAGGGGTGGGG - Intergenic
1028889459 7:95970831-95970853 AGAGATATTTACAAGGTGGGTGG + Intronic
1028916442 7:96264315-96264337 ATAGTTATCTAGAAGTGGGAGGG - Intronic
1029152609 7:98491649-98491671 AGACAGATGGAGCAGGGGGATGG - Intergenic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1029521356 7:101064697-101064719 AGAGATATGTGGGAAGAGGAGGG - Intergenic
1029631712 7:101755763-101755785 AGACATATGTAGACTGGGTATGG - Intergenic
1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG + Intronic
1030163779 7:106532946-106532968 AGAGACACGGAGAAGGGGGGTGG + Intergenic
1030620837 7:111789543-111789565 AGAGATAAAGACAAGGGGGAAGG + Intronic
1030645143 7:112052746-112052768 AGAGACATATCAAAGGGGGATGG - Intronic
1030726199 7:112927613-112927635 AGAGACAGGTACAAGGGGAAAGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031296451 7:120010069-120010091 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031381808 7:121095205-121095227 TGGGCTATGGAGAAGGGGGATGG + Intronic
1032489240 7:132311661-132311683 AGAGATGTGTGGGACGGGGAGGG - Intronic
1033348378 7:140542500-140542522 AGAGAGAGGAAGATGGGGGAGGG - Intronic
1033399461 7:141008064-141008086 AGAGATCTGCAAAAGAGGGAGGG - Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1034532418 7:151704657-151704679 AGAGAGATGAGGAAAGGGGAGGG + Intronic
1035038047 7:155908162-155908184 AGAGGTAGGGAGAAGGGGGAGGG + Intergenic
1037285846 8:17299402-17299424 AGAAATATGTATAAGAGGGTCGG + Exonic
1037899188 8:22677611-22677633 AGAGAAATAGAGAAGGGGGAGGG + Intergenic
1038868313 8:31464211-31464233 AGAGATATGGAGGTGAGGGAGGG + Intergenic
1041031829 8:53744621-53744643 AGAAATAAGTAGATGGGGGTCGG + Intronic
1041917698 8:63152847-63152869 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1042762330 8:72284375-72284397 TGAGATATCTTCAAGGGGGATGG - Intergenic
1043260257 8:78186456-78186478 AGAGATCTGTAGAACAGGCATGG - Intergenic
1044754672 8:95448596-95448618 AGAGATTCCTAGAAGTGGGATGG + Intergenic
1045285761 8:100789791-100789813 AGAGATTTCTAGTAGGGGGTTGG + Intergenic
1045879223 8:107018257-107018279 TGAGCTAAGTAGTAGGGGGAAGG + Intergenic
1046293964 8:112197033-112197055 AGAGACATGGAGAAGGGGTGGGG - Intergenic
1046597376 8:116276331-116276353 AGAGATAGGGAGAAGGGCAAGGG + Intergenic
1046651054 8:116837105-116837127 AGAAATATGTTGAAGTGGGATGG + Intronic
1048528504 8:135226396-135226418 TGAGATATGGAGTAGGGGCAAGG + Intergenic
1048585573 8:135771644-135771666 AGAGACACGGAGAAGGGGTAGGG + Intergenic
1048764385 8:137829345-137829367 AGAGACATGGAGAAGGGGTGAGG + Intergenic
1049350591 8:142162443-142162465 AAAGAGATGAAGATGGGGGATGG + Intergenic
1049350724 8:142163161-142163183 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350754 8:142163332-142163354 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350784 8:142163468-142163490 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350828 8:142163722-142163744 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350857 8:142163893-142163915 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350878 8:142163993-142164015 AGAGAGATGGAGATGAGGGATGG + Intergenic
1049350898 8:142164081-142164103 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350914 8:142164170-142164192 AGAGAGATGAAGATGGAGGATGG + Intergenic
1049350932 8:142164257-142164279 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049966510 9:784993-785015 AGAGATGTATGGAAGGGGTATGG + Intergenic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1052333649 9:27297561-27297583 AGAGATAGTGAGAAGGAGGATGG + Intergenic
1054472406 9:65548953-65548975 AGTGATAGGAAGAAGGGGCAGGG + Intergenic
1055815009 9:80194689-80194711 AGAGATAAGTAGGGTGGGGAGGG + Intergenic
1057377827 9:94541040-94541062 AGAGACATGGAGAAGGGGTGGGG - Intergenic
1057812744 9:98270358-98270380 AGAGACACGGAGAAGGGGGTGGG + Intergenic
1059153043 9:111966398-111966420 AAAGATATGAAGAAAGGGGTGGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059949064 9:119443029-119443051 AGAGATATGTGGAAAGAGCAGGG - Intergenic
1060276021 9:122183254-122183276 AGGGACGTGTAGGAGGGGGAAGG - Intronic
1062185757 9:135217646-135217668 AGACAGAGGTAGAAGGAGGAGGG - Intergenic
1185708444 X:2282534-2282556 GGAGATAGGGAGAAGAGGGAGGG + Intronic
1186631641 X:11355769-11355791 AGTGATATGAGGAAGAGGGAGGG + Intronic
1186975088 X:14893923-14893945 AGAGATATGGTAAAAGGGGATGG + Intronic
1187103931 X:16221342-16221364 AGAGACATGGAGAAGGGGGTTGG + Intergenic
1187390766 X:18885253-18885275 AGAGAAATATTGAAGGGGAAGGG - Intergenic
1189052660 X:37663046-37663068 TGAGAGATGTAGAAGGAAGAAGG - Intronic
1189725792 X:43967019-43967041 AGACATATGTCAAAGGGGCAAGG + Intronic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190755221 X:53395674-53395696 AAAGATTTGTAGCAAGGGGATGG - Intronic
1190882280 X:54500374-54500396 AGAGATATTTAGAATTGAGAAGG + Intergenic
1192323971 X:70116521-70116543 AAAGATATTTTGAAGGGTGAGGG + Intergenic
1193095526 X:77544374-77544396 AGAGCTAATCAGAAGGGGGAAGG - Intronic
1193207309 X:78764484-78764506 AGAGAAAGCAAGAAGGGGGAGGG - Intergenic
1193363954 X:80608368-80608390 AGTGAGAAGTAGAAGGGGCAGGG - Intergenic
1194293774 X:92104726-92104748 AGAGACATGGAGAAGGGGTGGGG + Intronic
1194686626 X:96925776-96925798 AAACATATGTAGAAGGGTGGTGG - Intronic
1194790671 X:98145625-98145647 AGAGGTAGATAGAAGAGGGAAGG - Intergenic
1195017119 X:100790965-100790987 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1195022044 X:100838620-100838642 ACAGAAATGTAGAAGGTGAAAGG + Intronic
1195557202 X:106240810-106240832 AGAGAGAGGAAGAAGTGGGAGGG + Intergenic
1196143847 X:112295585-112295607 GGACATAAGTAGAAGCGGGATGG - Intergenic
1196144792 X:112304843-112304865 AGAGAGATGCAGGAGTGGGATGG - Intergenic
1196584951 X:117418831-117418853 AGAGACATGGGGAAGGGGGGTGG - Intergenic
1196729140 X:118923718-118923740 TGGGAAATGTAGTAGGGGGAAGG - Intergenic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1198116466 X:133549629-133549651 AGAGAGATAAAGAGGGGGGAGGG - Intronic
1198824688 X:140686882-140686904 GGAGATGTGGAGAAAGGGGAGGG + Intergenic
1198983910 X:142428068-142428090 AGAGACACGGAGAAGGGGGTGGG + Intergenic
1199405569 X:147454981-147455003 AGAGAAAAGTAAAACGGGGAGGG + Intergenic
1199757533 X:150879298-150879320 AGAGAGATGTTGAAGGATGAAGG + Intronic
1202327918 Y:23711914-23711936 AGAGGTATGTAGAAAGTGTAAGG + Intergenic
1202542852 Y:25958138-25958160 AGAGGTATGTAGAAAGTGTAAGG - Intergenic