ID: 1109766349

View in Genome Browser
Species Human (GRCh38)
Location 13:66904626-66904648
Sequence TCATTGATGAATAGGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109766349 Original CRISPR TCATTGATGAATAGGAAACA TGG (reversed) Intronic
902267509 1:15278422-15278444 TAACTGAGGAATAGGAAAAAGGG + Intronic
902492986 1:16798894-16798916 AGATTGATTAATAGGAAAAAAGG + Intronic
904138901 1:28336289-28336311 TGATAGATGAATGGGAAAAAAGG - Intergenic
905243596 1:36597001-36597023 TCATGGGTGATGAGGAAACAGGG - Intergenic
907308986 1:53528746-53528768 TCACAGATGAGGAGGAAACAGGG - Intronic
908225109 1:62048116-62048138 TCATTTATGAATTGGGATCATGG + Intronic
908398603 1:63749300-63749322 TTAAAGATGAATAGGAGACAGGG - Intergenic
909202000 1:72701512-72701534 ACATAGATGAATGGGAAAGAGGG - Intergenic
912380801 1:109247286-109247308 TCAGTGATGCATATGAAACTTGG + Intergenic
915735996 1:158085584-158085606 TCTTTAATGAATATGAAAAATGG - Intronic
918161211 1:181901947-181901969 TCATTGATTTTTAAGAAACAGGG - Intergenic
918367954 1:183829016-183829038 GCATTGATGATTAAGAACCATGG - Intronic
918857244 1:189773026-189773048 TCATGCATGAACAGGAATCAAGG + Intergenic
921137891 1:212278674-212278696 GCAGTGAGGAAGAGGAAACAGGG - Intergenic
921857110 1:219998876-219998898 TCATTCATGGTTAGTAAACAGGG + Intronic
923264813 1:232304266-232304288 TCAGAGATGGATAGCAAACAGGG - Intergenic
923527459 1:234783634-234783656 AGATTGATTAATAGGAAAAAAGG - Intergenic
923568350 1:235093251-235093273 GAATTGATGAGGAGGAAACAAGG - Intergenic
1063745496 10:8875215-8875237 TCCTTGATGATTAGGTATCATGG - Intergenic
1066289062 10:33997571-33997593 CCAGTGATGATTAAGAAACATGG + Intergenic
1068368568 10:56084291-56084313 TCAGTGATGAATTAGAAAAAAGG - Intergenic
1068756318 10:60658271-60658293 TACTTGATTAATAGAAAACAAGG - Intronic
1068819914 10:61362900-61362922 TCATTCATAAATAAAAAACAAGG - Intergenic
1070199005 10:74185402-74185424 TCAATGTTGAGTAGGAAAGAAGG + Intronic
1074505735 10:114068801-114068823 ACAGTGATGAAAAGAAAACAAGG + Intergenic
1074746779 10:116542391-116542413 GCATTGGTAAATAGGACACATGG + Intergenic
1075861829 10:125683724-125683746 ACATTTACAAATAGGAAACAAGG + Intergenic
1078409364 11:11099267-11099289 TAATAGATAAATAGGAAAAAAGG + Intergenic
1079717281 11:23764232-23764254 AGATTGATTAATAGGAAAAAAGG + Intergenic
1080217483 11:29861874-29861896 TCATCGATGAATATGAAAGAAGG - Intergenic
1081941102 11:46942842-46942864 GCAATGATGCATAGTAAACAGGG + Intronic
1082651139 11:55795452-55795474 TCTTTGATTAAAAGGAAAAAAGG - Intergenic
1088459180 11:110064635-110064657 GAATTGATGAATAGGAAGCAGGG - Intergenic
1090322043 11:125854416-125854438 TCATTCAGGTATAGGAAACTTGG + Intergenic
1090747611 11:129719971-129719993 TTATTGATGACTAGGAAGGAAGG - Intergenic
1092985490 12:13841371-13841393 TTATTGATGAATATGTCACACGG + Intronic
1095986012 12:48000342-48000364 TCACTGGTGAATAGACAACATGG - Intronic
1098905276 12:76155435-76155457 TAAGTGATGAATAAGTAACAGGG + Intergenic
1099606347 12:84806428-84806450 ACAATGATGAATAAGAAAGAAGG - Intergenic
1100107711 12:91197112-91197134 TTATTGATTAATAGGAATGAAGG + Intergenic
1100326484 12:93544437-93544459 AAATTGATGAATAGAAAAAAGGG - Intergenic
1100373389 12:93990402-93990424 AGATTGATGAATAGGAGAAAAGG + Intergenic
1101811293 12:108110285-108110307 TCATGGCTGAAAAGCAAACAGGG + Intergenic
1106605702 13:31226349-31226371 TGATTGAAGTATAGGAAAAAGGG + Intronic
1107774157 13:43820698-43820720 TCTTTGATTAACTGGAAACATGG - Intergenic
1108190294 13:47931507-47931529 ACAATGATCAATAGGAGACATGG - Intergenic
1109368701 13:61392927-61392949 AAATTGATGAAAAGAAAACAAGG - Intergenic
1109505044 13:63288789-63288811 TCATTGCAGAATAAGAAAAATGG - Intergenic
1109599121 13:64599880-64599902 TCATTCATAAATAATAAACAAGG + Intergenic
1109766349 13:66904626-66904648 TCATTGATGAATAGGAAACATGG - Intronic
1109971657 13:69778657-69778679 TGATTAGTGAATAAGAAACAAGG + Intronic
1110095846 13:71519396-71519418 TGATTGATGATGATGAAACATGG + Intronic
1110950607 13:81485224-81485246 TCATTGATGAAAATGCAAAATGG - Intergenic
1111486029 13:88900591-88900613 TCATCAATAAAAAGGAAACAAGG - Intergenic
1113606122 13:111608287-111608309 CCATAGATGAACAGGAAGCATGG + Intronic
1116046820 14:39753660-39753682 TAATTGAAAAATAGGAAACAGGG + Intergenic
1117437006 14:55725574-55725596 TCAGTAATGAATAAGAAAAATGG + Intergenic
1118390668 14:65292814-65292836 TATTTGATCAATAGAAAACATGG + Intergenic
1119876079 14:78060550-78060572 TCATTTTAGAACAGGAAACATGG - Intergenic
1121070182 14:91012206-91012228 TTATTGAGGAATAGGGAATAAGG - Intronic
1125010657 15:34869979-34870001 TCAGTGATGAATAGTATAAAGGG - Intronic
1125879899 15:43185127-43185149 TGAATGATGAATAAGAAAGACGG + Exonic
1126531743 15:49718399-49718421 TCATTGCTTAATCGGAAGCAAGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130854027 15:87824980-87825002 TTATTAATGAAGAGGAAAAATGG - Intergenic
1130874075 15:87996982-87997004 TCATTTAGGAAGAGGAAACAGGG - Intronic
1138042357 16:53685902-53685924 TCATAGATGAAAAGGCAGCAAGG + Intronic
1138930956 16:61655417-61655439 TCATTTATGAATCAGAAAAAGGG + Intronic
1141538311 16:84699297-84699319 TCATTCATTATTAAGAAACAGGG - Intergenic
1142424030 16:89991266-89991288 TCATCAATGAATAAGATACATGG - Intergenic
1142549398 17:728805-728827 TCATTAAGGAATAGGACACAGGG - Intergenic
1142724328 17:1801055-1801077 ACATTGAAGAATAGGGACCAAGG - Intronic
1143622108 17:8086582-8086604 TCATTGATGAATGGGAGAAGGGG - Intronic
1146860857 17:36297055-36297077 TCAGTGATGTACAGGAAAGAAGG - Intronic
1147091186 17:38101149-38101171 TCAGTGATGTACAGGAAAGAAGG - Intergenic
1147106026 17:38219355-38219377 TCAGTGATGTACAGGAAAGAAGG + Intergenic
1148423483 17:47569163-47569185 TCAGTGATGTACAGGAAAGAAGG - Intronic
1148944774 17:51251338-51251360 TCAGTGAAGACTTGGAAACATGG - Intronic
1149295287 17:55256597-55256619 TCATTGATAAATAAGGAAAAAGG - Intergenic
1151001035 17:70376949-70376971 TGATTGTTAAATAGGAAAAAAGG + Intergenic
1151142482 17:72007146-72007168 TCATGGATGAATTTGACACATGG - Intergenic
1152246025 17:79184969-79184991 CCATTGAGGAAGAGGGAACAAGG + Intronic
1152975258 18:210472-210494 TCATGGGTGAAAAGGAAACAAGG + Exonic
1153604535 18:6818557-6818579 TTATTGATGAATGAGAAGCAGGG + Intronic
1154207835 18:12353100-12353122 TCATCGATGAAGAGGATGCAAGG + Exonic
1155563559 18:27107668-27107690 GCACTGATGAAGAGGAAAGATGG + Intronic
1159117303 18:64129605-64129627 AGATTCCTGAATAGGAAACATGG - Intergenic
1159321108 18:66850081-66850103 TCATTCAGGCATAGGAACCAAGG + Intergenic
1163087913 19:14995908-14995930 TCATTGATGAAGAAGAGAGAGGG + Intronic
1167767815 19:51495888-51495910 TGAAGGATGAATAGGAATCAGGG + Intronic
926680409 2:15658938-15658960 TCATAGAAGAATTGAAAACAGGG - Intergenic
927019426 2:19001373-19001395 TCAATGTTGAATACGAAACAAGG + Intergenic
927539691 2:23897814-23897836 TCATTGACTAAGAGGAACCAAGG - Intronic
928461130 2:31473684-31473706 TTGTTGATGAATAAGATACAGGG + Intergenic
929969025 2:46557307-46557329 ACATTGATGCATAGTAAAAAGGG + Intronic
930479115 2:51924976-51924998 CAATTGATAAATAGGAAACTAGG - Intergenic
930575831 2:53147250-53147272 TCATTCATGGATAGCAAAAAAGG - Intergenic
930819494 2:55631130-55631152 TTATTAACGAATATGAAACAAGG - Intergenic
931410855 2:62029890-62029912 AGATTGATTAATAGGAAAAAAGG + Intronic
931876794 2:66522322-66522344 TCATCTATCAATAGGAAACATGG - Intronic
933553177 2:83801221-83801243 TCATCGAGGAATAAGAAACCAGG - Intergenic
935460299 2:103323512-103323534 TCATGGATGAACAACAAACATGG + Intergenic
935486930 2:103667989-103668011 TAATTGAAGAATAGGAATAATGG - Intergenic
935807095 2:106759948-106759970 ACATTGATTAATAGGAGAAAAGG + Intergenic
936379015 2:111967890-111967912 TCATTAGTGAATAGGAAAGTGGG + Intronic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
939760774 2:146175573-146175595 GCATTGGTGAATTGGAAGCATGG + Intergenic
939871992 2:147536030-147536052 GCCTTTATGAATAAGAAACAGGG - Intergenic
940291982 2:152085968-152085990 TAATTGTTGAATAAAAAACAAGG - Intronic
940415404 2:153413494-153413516 TCAATGCTAAATAGGAAATATGG - Intergenic
941059359 2:160827835-160827857 TCAGGGATGAAAAGGAACCATGG + Intergenic
941621795 2:167787371-167787393 TCATTTCTGATGAGGAAACAGGG - Intergenic
942106700 2:172640802-172640824 TAATTGATTAATAGGAGAAAGGG + Intergenic
942173659 2:173310601-173310623 TCATTGAGGAATTGCAAACAGGG + Intergenic
943267769 2:185757594-185757616 TCAATGATGAAATGGAAACCAGG - Intronic
943480524 2:188411673-188411695 TGATTGAAAAATTGGAAACAAGG - Intronic
945364690 2:208937531-208937553 ATGTTGAAGAATAGGAAACATGG - Intergenic
947052473 2:226061489-226061511 TCATTCATAAAAAGAAAACAAGG + Intergenic
1169910295 20:10642592-10642614 TCATTGATGTCTAGGAGAAATGG + Exonic
1170043305 20:12060721-12060743 TTACTCATGAGTAGGAAACATGG + Intergenic
1170764366 20:19277282-19277304 TCATCCATGAAGATGAAACATGG + Intronic
1173377109 20:42495777-42495799 TTATATATGAAAAGGAAACATGG - Intronic
1175481787 20:59316549-59316571 TCATTCATGAAAAGGCAACACGG + Intronic
1177563901 21:22794095-22794117 TTAATGAGGAAAAGGAAACAGGG + Intergenic
1177828251 21:26107839-26107861 GCATTGATGAACAGAACACAGGG - Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
949332863 3:2941533-2941555 TTATTGATGCATAGGATAAATGG - Intronic
951688004 3:25365924-25365946 CCATTCATGGAGAGGAAACAGGG + Intronic
953010448 3:39020518-39020540 TCAGTGAGGAACAGGAAAAAAGG + Intergenic
954245454 3:49327987-49328009 TCATGGATAAAGAGAAAACATGG - Intronic
954981092 3:54745911-54745933 TCATAGATGATTATGAAAAATGG - Intronic
955575754 3:60361064-60361086 TCACTGAGTAGTAGGAAACAGGG - Intronic
956204925 3:66745455-66745477 TCTTTGATGAACAGAGAACAGGG + Intergenic
956672854 3:71707636-71707658 TCATAGGTGATTAGGAAAAAGGG - Intronic
957618032 3:82557008-82557030 TCTATAATGAATGGGAAACAAGG - Intergenic
957925113 3:86799125-86799147 TGAATGAAGAATAAGAAACAGGG - Intergenic
958158738 3:89789406-89789428 TTATTGATGAAGTAGAAACATGG - Intergenic
958776740 3:98493457-98493479 TCATGGAGGAATTGGAAACCAGG - Intergenic
960933925 3:122883887-122883909 TCATTCCCGAATAGGAAATAAGG + Intergenic
962169514 3:133086197-133086219 TCAATGATGGATAGGTCACAAGG - Intronic
962448420 3:135490640-135490662 TAATTACTGAATAGGAAATAGGG - Intergenic
963489458 3:145981336-145981358 TTATTGCTGAATAAGAAACAAGG + Intergenic
963855835 3:150252406-150252428 TCATTGACCAAGAGGAAAGAGGG + Intergenic
964660063 3:159110643-159110665 ACAGTGATGAATAAGAAAGACGG - Intronic
965391286 3:168107520-168107542 TTATTGATGAATATTAAACAGGG + Intergenic
965920881 3:173912218-173912240 TCATTGATGAGCAAGTAACAAGG + Intronic
966679886 3:182630666-182630688 TCAGTGATCATAAGGAAACAAGG + Intergenic
967518021 3:190393443-190393465 TCATTACTGAATAGGAAATGTGG - Intronic
972076102 4:35089483-35089505 GCATTGATGAATAGTAATCATGG - Intergenic
972906136 4:43749772-43749794 TCATTGATGCTCAGAAAACAGGG + Intergenic
974573015 4:63679810-63679832 TTAATGATAAATGGGAAACAGGG + Intergenic
975291838 4:72686327-72686349 TCATTGCTGAATGGGAAAGATGG - Intergenic
975495631 4:75033252-75033274 TCATTCTTGAATAGTAAACTTGG - Intronic
977122657 4:93122775-93122797 TAATTGATAAATACGATACAAGG - Intronic
977346884 4:95827573-95827595 TTATTGATGTATAAGAACCAAGG - Intergenic
978643060 4:110893946-110893968 TCATTGATAAATAATAAACAGGG - Intergenic
979333025 4:119438455-119438477 TAATTTATGAAAAGGAAAAAAGG + Intergenic
979363284 4:119790022-119790044 TGAGTGATCAATAGGAAATAGGG + Intergenic
980254680 4:130363285-130363307 TCATTGAAGAAAAGAAAAAAAGG - Intergenic
980479060 4:133361526-133361548 TGATTGATGTATAAAAAACAAGG - Intergenic
980490284 4:133515540-133515562 TCATTTATGAAGAGAAAATAAGG - Intergenic
981506199 4:145502725-145502747 TCCTTGATGAAAAGGAAGCAAGG - Intronic
983235630 4:165176095-165176117 TGATGGATGAACAGGCAACAAGG - Intronic
983476480 4:168218333-168218355 TTAAGGATGTATAGGAAACAAGG - Intronic
983863513 4:172736115-172736137 TCATTGATGAACAGGAAACAGGG + Intronic
984273319 4:177574852-177574874 GCATAGAGGAAAAGGAAACAAGG + Intergenic
986421287 5:7586567-7586589 TCATTTTCGAATAGGAGACAAGG + Intronic
988332604 5:29861866-29861888 ACATAGATAAATAGGAAAAAGGG - Intergenic
989327822 5:40220571-40220593 TCCCCGATGAAAAGGAAACAGGG + Intergenic
993257489 5:85611200-85611222 TCAGTGATGAAAAGGAGACAGGG - Intergenic
993746647 5:91607218-91607240 ACATTGCTGAATAATAAACATGG + Intergenic
994022226 5:95040642-95040664 TCAGTTATGAAGAGGAAACTGGG - Intronic
994316005 5:98334106-98334128 TCCTTGATGACTCAGAAACATGG + Intergenic
994384270 5:99110861-99110883 TCTTTTATGAAAAGGCAACAAGG - Intergenic
994798768 5:104342827-104342849 TTCTTGATGAATAGAAAACTTGG - Intergenic
996107750 5:119525141-119525163 TAAATGAAAAATAGGAAACATGG - Intronic
996333850 5:122362018-122362040 TCAGTGATGATTAGGAAATTAGG - Intronic
996577256 5:124989077-124989099 ACATTGATTAATAGGAAAGTTGG + Intergenic
997606971 5:135182250-135182272 CCATTGAGCCATAGGAAACATGG + Intronic
998563085 5:143189935-143189957 TTATTGTTGAGTAGTAAACAAGG + Intronic
999121299 5:149211449-149211471 ACCTTGATGAATTAGAAACAGGG + Intronic
1000000177 5:157130886-157130908 AGATTGAGGAATAGGAAACCAGG - Intronic
1000230248 5:159309435-159309457 TCAGTGGTGAATAGGGGACAGGG + Intergenic
1000853958 5:166376701-166376723 GCATTGGTTACTAGGAAACATGG + Intergenic
1001810985 5:174628034-174628056 TAGTTGACAAATAGGAAACAAGG - Intergenic
1003063887 6:2885646-2885668 GCATTGTTGAATAGCAAAAAAGG - Intergenic
1004511078 6:16285258-16285280 TACATGAGGAATAGGAAACATGG + Intronic
1004802603 6:19167064-19167086 TCATTGATGAGTAAGAAGAAAGG + Intergenic
1004855260 6:19743389-19743411 ATAATGATGAGTAGGAAACAAGG - Intergenic
1007160043 6:39783331-39783353 TCAAGGAGGAATAGGAGACATGG - Intergenic
1008720646 6:54346255-54346277 ACAATGATGAACAAGAAACAAGG - Intronic
1008734095 6:54520940-54520962 TCTATGATGAATAACAAACAAGG + Intergenic
1008795974 6:55303480-55303502 AAACTGATGAATGGGAAACATGG + Intergenic
1009675811 6:66819175-66819197 TCATTGATTAGAAGGAAACTAGG - Intergenic
1010702922 6:79073678-79073700 TCAGAGATGAATAGGAATGATGG - Intronic
1012083386 6:94789697-94789719 TGATTGTTGACTAGAAAACATGG - Intergenic
1012326415 6:97924800-97924822 TCATTGATGAAAAGGGAAGTAGG - Intergenic
1013286962 6:108690023-108690045 TCGTTTATGAAATGGAAACAGGG + Intergenic
1013842357 6:114412628-114412650 TCACTGATAAATAAGAAAAAAGG + Intergenic
1015344845 6:132144315-132144337 TGTTTGAAGAATTGGAAACAGGG - Intergenic
1015502393 6:133947958-133947980 ACATTGAAAAATAGGCAACAAGG - Intergenic
1016040384 6:139426819-139426841 TCAATGATGAATTAGAATCAGGG - Intergenic
1018575178 6:165252275-165252297 CCATAGATCAATAGAAAACAAGG + Intergenic
1021294333 7:18885829-18885851 TCCATGAGAAATAGGAAACATGG - Intronic
1021607317 7:22421175-22421197 TAAGTGATGAAAAGGATACAAGG + Intronic
1022689422 7:32632285-32632307 TAATTTATGAAACGGAAACATGG - Intergenic
1022917000 7:34966636-34966658 TAATTTATGAAACGGAAACATGG - Intronic
1024319817 7:48053906-48053928 TCTTTGATTAAGAGGAAAGATGG + Intronic
1024803314 7:53106680-53106702 TAATTGCTGAATAGGTAACATGG - Intergenic
1024940836 7:54761376-54761398 ACATTGATGAATGACAAACATGG + Intergenic
1025006752 7:55361680-55361702 TCATGAAAGAATAGAAAACAGGG - Intergenic
1027468876 7:78548960-78548982 CCATGGATGAATAGTAAAAAGGG - Intronic
1027490688 7:78822023-78822045 ACACTGATGAATATGCAACATGG + Intronic
1027950776 7:84812192-84812214 TCATTGCCAAAAAGGAAACAAGG + Intergenic
1027951529 7:84822958-84822980 ACATTGATGAATAGAATAAAAGG - Intergenic
1031188438 7:118513579-118513601 ATATTGATGGAGAGGAAACAAGG - Intergenic
1031744646 7:125478633-125478655 TCATTAATGGATAAGAAAGAAGG + Intergenic
1039593819 8:38772612-38772634 CCATGGATGAAGAGGAAACCAGG - Intronic
1041990779 8:63988914-63988936 TCTATGATCAAGAGGAAACACGG - Intergenic
1043459488 8:80445409-80445431 TCATTTAGGAATAGGAAGGAAGG - Intergenic
1043463230 8:80481498-80481520 TCATTGAGGAAAAGAAAAAAAGG - Intergenic
1044848282 8:96403111-96403133 TCAATAATGTATATGAAACAAGG + Intergenic
1045255950 8:100521813-100521835 TCTTTGATGACTAGGATACTCGG + Intronic
1045998711 8:108394426-108394448 TCATTGAAGAATGTTAAACAAGG - Intronic
1046136636 8:110035797-110035819 ACATAAATGATTAGGAAACAAGG - Intergenic
1046170890 8:110503971-110503993 TCATTTAAGAATAGGAGACCAGG - Intergenic
1046187421 8:110739926-110739948 ACAATGAAGAAAAGGAAACAAGG - Intergenic
1046374011 8:113351832-113351854 TCATTGATGACAAGAAAACAAGG - Intronic
1046730912 8:117725340-117725362 TCATTGAAGAATATTAAGCAGGG + Intergenic
1047768306 8:128008399-128008421 TCATTGATAAATTGGAAGAAAGG - Intergenic
1050221171 9:3391895-3391917 TCATTGAGGAATACCAAGCATGG + Intronic
1051338913 9:16093194-16093216 TCTTTGATGAAAAGCAAATACGG + Intergenic
1051866577 9:21689888-21689910 TCAGTCATGAATAGGAAATTTGG + Intergenic
1051876645 9:21801322-21801344 CCTTTGAGGAATAGGAGACAGGG - Intergenic
1051904008 9:22074419-22074441 TCTTTGATGAAGAGGACATAGGG + Intergenic
1052170900 9:25395156-25395178 AGATTGATTAATAGGAAAAAAGG + Intergenic
1053100379 9:35366726-35366748 TCCTTGGTGAATAGGAGATAGGG - Intronic
1053826084 9:42026006-42026028 TCTTGGATGAATTGGAAACCTGG - Intronic
1054604479 9:67161390-67161412 TCTTGGATGAATTGGAAACCTGG + Intergenic
1054979948 9:71194332-71194354 TCAAGGAAGAAGAGGAAACAGGG - Intronic
1056619769 9:88202213-88202235 TCATTGTTCACTGGGAAACATGG - Intergenic
1056649933 9:88450405-88450427 TCATAGATGATTAGAAAATACGG - Intronic
1056990830 9:91408451-91408473 TTAATGATGAATAGGAAGAATGG - Intergenic
1058712156 9:107689101-107689123 CCATTGCTGAATGGGAATCAAGG + Intergenic
1059779845 9:117514873-117514895 TTCTTGATGAATAGGACTCAAGG + Intergenic
1060536486 9:124393143-124393165 TGATTGATGAATATAAAATAAGG + Intronic
1186037486 X:5440749-5440771 TCATTGCGGAAGGGGAAACAAGG + Intergenic
1186055799 X:5648565-5648587 TTATTTATTATTAGGAAACATGG - Intergenic
1187439104 X:19301668-19301690 ACAGTAATGAATAGGAAAAAAGG + Intergenic
1187673720 X:21694430-21694452 TCATTGTTGAATTGCAACCATGG - Intergenic
1188322758 X:28760358-28760380 ACAAAAATGAATAGGAAACAGGG + Intronic
1189606242 X:42681188-42681210 TCCTTGGAGAATAAGAAACAGGG - Intergenic
1193629885 X:83871256-83871278 TCAATGATAAATAAGAAAAATGG + Intronic
1194395154 X:93374206-93374228 TCATGGATCAATAGTACACATGG + Intergenic
1194695491 X:97044606-97044628 TCACTGAGGAATGGGAACCAGGG - Intronic
1195238329 X:102924877-102924899 TCATTGATGGATGGTATACATGG - Intergenic
1196259045 X:113555894-113555916 TCACAGAGGAATAGGAAACCTGG + Intergenic
1197257437 X:124278758-124278780 TAACAGATGAATGGGAAACAGGG - Intronic
1197373269 X:125650349-125650371 ACATTAATCAAAAGGAAACATGG - Intergenic
1197569287 X:128129523-128129545 TCATTGATGACTAGTGAAAAAGG + Intergenic
1197951185 X:131898900-131898922 TCATTGGTGATTTGGAAAGATGG + Intergenic
1198128193 X:133668205-133668227 TCATTGAAGAGTAGAAAATAGGG - Intronic
1198957107 X:142145494-142145516 TCAATGGGCAATAGGAAACATGG - Intergenic
1199300553 X:146208508-146208530 TGATTGAGGAACAGGAGACAAGG + Intergenic
1201355413 Y:13092353-13092375 TCACTGTTGAATGGGAAAAAGGG - Intergenic