ID: 1109766463 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:66906549-66906571 |
Sequence | TAGGGATGGAAGGACTTAAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 119 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 110} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1109766463_1109766472 | 17 | Left | 1109766463 | 13:66906549-66906571 | CCAGTTAAGTCCTTCCATCCCTA | 0: 1 1: 0 2: 0 3: 8 4: 110 |
||
Right | 1109766472 | 13:66906589-66906611 | GCCTCTCCTGTGTTTCATTCTGG | 0: 1 1: 0 2: 1 3: 12 4: 171 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1109766463 | Original CRISPR | TAGGGATGGAAGGACTTAAC TGG (reversed) | Intronic | ||