ID: 1109766466 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:66906567-66906589 |
Sequence | CTTGGGGGTGAGATCTTTTA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 143 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 134} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1109766466_1109766477 | 29 | Left | 1109766466 | 13:66906567-66906589 | CCCTAAAAGATCTCACCCCCAAG | 0: 1 1: 0 2: 0 3: 8 4: 134 |
||
Right | 1109766477 | 13:66906619-66906641 | CCTGTTTTTGGAACAGTGAATGG | 0: 1 1: 0 2: 0 3: 16 4: 241 |
||||
1109766466_1109766475 | 17 | Left | 1109766466 | 13:66906567-66906589 | CCCTAAAAGATCTCACCCCCAAG | 0: 1 1: 0 2: 0 3: 8 4: 134 |
||
Right | 1109766475 | 13:66906607-66906629 | TCTGGAGCAGCTCCTGTTTTTGG | 0: 1 1: 0 2: 1 3: 23 4: 204 |
||||
1109766466_1109766472 | -1 | Left | 1109766466 | 13:66906567-66906589 | CCCTAAAAGATCTCACCCCCAAG | 0: 1 1: 0 2: 0 3: 8 4: 134 |
||
Right | 1109766472 | 13:66906589-66906611 | GCCTCTCCTGTGTTTCATTCTGG | 0: 1 1: 0 2: 1 3: 12 4: 171 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1109766466 | Original CRISPR | CTTGGGGGTGAGATCTTTTA GGG (reversed) | Intronic | ||