ID: 1109766467

View in Genome Browser
Species Human (GRCh38)
Location 13:66906568-66906590
Sequence GCTTGGGGGTGAGATCTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109766467_1109766475 16 Left 1109766467 13:66906568-66906590 CCTAAAAGATCTCACCCCCAAGC 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1109766475 13:66906607-66906629 TCTGGAGCAGCTCCTGTTTTTGG 0: 1
1: 0
2: 1
3: 23
4: 204
1109766467_1109766477 28 Left 1109766467 13:66906568-66906590 CCTAAAAGATCTCACCCCCAAGC 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1109766477 13:66906619-66906641 CCTGTTTTTGGAACAGTGAATGG 0: 1
1: 0
2: 0
3: 16
4: 241
1109766467_1109766472 -2 Left 1109766467 13:66906568-66906590 CCTAAAAGATCTCACCCCCAAGC 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109766467 Original CRISPR GCTTGGGGGTGAGATCTTTT AGG (reversed) Intronic