ID: 1109766472

View in Genome Browser
Species Human (GRCh38)
Location 13:66906589-66906611
Sequence GCCTCTCCTGTGTTTCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109766463_1109766472 17 Left 1109766463 13:66906549-66906571 CCAGTTAAGTCCTTCCATCCCTA 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766466_1109766472 -1 Left 1109766466 13:66906567-66906589 CCCTAAAAGATCTCACCCCCAAG 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766462_1109766472 18 Left 1109766462 13:66906548-66906570 CCCAGTTAAGTCCTTCCATCCCT 0: 1
1: 0
2: 1
3: 13
4: 198
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766467_1109766472 -2 Left 1109766467 13:66906568-66906590 CCTAAAAGATCTCACCCCCAAGC 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766464_1109766472 7 Left 1109766464 13:66906559-66906581 CCTTCCATCCCTAAAAGATCTCA 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766465_1109766472 3 Left 1109766465 13:66906563-66906585 CCATCCCTAAAAGATCTCACCCC 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109766472 Original CRISPR GCCTCTCCTGTGTTTCATTC TGG Intronic