ID: 1109766472

View in Genome Browser
Species Human (GRCh38)
Location 13:66906589-66906611
Sequence GCCTCTCCTGTGTTTCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109766464_1109766472 7 Left 1109766464 13:66906559-66906581 CCTTCCATCCCTAAAAGATCTCA 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766462_1109766472 18 Left 1109766462 13:66906548-66906570 CCCAGTTAAGTCCTTCCATCCCT 0: 1
1: 0
2: 1
3: 13
4: 198
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766467_1109766472 -2 Left 1109766467 13:66906568-66906590 CCTAAAAGATCTCACCCCCAAGC 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766466_1109766472 -1 Left 1109766466 13:66906567-66906589 CCCTAAAAGATCTCACCCCCAAG 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766463_1109766472 17 Left 1109766463 13:66906549-66906571 CCAGTTAAGTCCTTCCATCCCTA 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
1109766465_1109766472 3 Left 1109766465 13:66906563-66906585 CCATCCCTAAAAGATCTCACCCC 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109766472 Original CRISPR GCCTCTCCTGTGTTTCATTC TGG Intronic
900296086 1:1950898-1950920 TTCTCTCCTGTGTTTTTTTCGGG + Intronic
903137095 1:21316715-21316737 GGCTCTCCTGTGGTTTATCCAGG - Intronic
904441441 1:30534481-30534503 TCCTCTCCAGTGTGTCCTTCAGG - Intergenic
909204095 1:72731200-72731222 GCCTTTACTGTTTTCCATTCTGG + Intergenic
910061249 1:83095397-83095419 TTCTTTCCTGTGTTACATTCTGG + Intergenic
910928095 1:92416821-92416843 GCCCCTCCTCTGTTAAATTCTGG + Intergenic
912069865 1:105796014-105796036 GCCCCTCCTGTGCTTGATTTGGG + Intergenic
912933194 1:113982253-113982275 TCCTCTCCTGTGTTTGTTTGGGG + Exonic
913106750 1:115621703-115621725 GCCTTCTCTGTGTTTCATTTTGG + Intergenic
917994069 1:180416399-180416421 GGCTCTACTGTGTTTCATAATGG - Intronic
920510616 1:206549158-206549180 GCCTGGCCTGTGCTTCATTTTGG + Intronic
920528020 1:206683215-206683237 GCATCTCCTGTGTGTGCTTCGGG + Intronic
920928078 1:210361626-210361648 CTCTCTCCTGGGTTTCCTTCTGG + Intronic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
1063802201 10:9592987-9593009 GTCTTACCTGTGTCTCATTCTGG - Intergenic
1063940766 10:11126574-11126596 GCCTTTCCCGTGGTTCACTCTGG + Intronic
1064107281 10:12510711-12510733 GCCGCTCCTGTGATTCATTCAGG - Intronic
1064256985 10:13750743-13750765 GCCTCTCCTGGGTTTGATCCAGG + Intronic
1064318084 10:14276662-14276684 TCCTCTCATCTGTTTCCTTCTGG - Intronic
1065875440 10:29993617-29993639 TTCTCTCCTTTGTTTCATCCTGG - Intergenic
1066119697 10:32273501-32273523 CTCTTTCCTGTGTTTAATTCAGG - Intronic
1071718245 10:88118307-88118329 GCCTCTCCTGTGTTTCCCTTTGG - Intergenic
1076396997 10:130146432-130146454 GCCTCTTTTGTTTTTCACTCTGG + Intronic
1077499805 11:2904211-2904233 GCCCTTCCTGTGTTTGCTTCTGG + Intronic
1078858728 11:15227858-15227880 GCCTCTCCTGTGGCTGACTCCGG + Intronic
1081415781 11:42813575-42813597 GCCTCTCATTTTTTTCATTTTGG - Intergenic
1081543301 11:44051631-44051653 GCCTCTCATGTGTTGTCTTCAGG + Exonic
1081698505 11:45136578-45136600 GCCTTTCCTGTGATTCCTTGTGG - Intronic
1082105825 11:48220434-48220456 GCCTTCACTGTGTTTCATTCTGG - Intergenic
1085826626 11:79854771-79854793 TCCTCAACTGTGTTTCATGCCGG + Intergenic
1089879056 11:121755947-121755969 GCCACTAATGTGTTTCATTTGGG - Intergenic
1090090858 11:123696566-123696588 GCTTCTCCTGTGTTTTCTGCAGG - Intergenic
1090132832 11:124162580-124162602 GCCTGTTCTGAGTTTCATTTAGG + Intergenic
1090529814 11:127578830-127578852 GCCTCGCCTTTGTTCCATTGAGG - Intergenic
1091033932 11:132216347-132216369 CCCTCACCTGAGTTTCATTTTGG - Intronic
1093888213 12:24487997-24488019 TCCTCTACTGTGTTTCAGTTGGG - Intergenic
1095193896 12:39290051-39290073 CCCTGTCCAGTGTTTTATTCAGG - Intergenic
1096164862 12:49413818-49413840 GCCTGTCCAGTGTTGCATACTGG - Intronic
1096205827 12:49720972-49720994 GCCTCTCCTGTTTGTTATTTAGG + Intronic
1096798926 12:54096606-54096628 GCCTCTGCCGTGTTTCCTGCTGG + Intergenic
1097704614 12:62855022-62855044 GACTCTCCTGTGTTTGACTCTGG - Intronic
1101467061 12:104958989-104959011 GCATCTACTGTGTATGATTCAGG + Intergenic
1105860263 13:24403899-24403921 GCCTCTCCTTTGTGGCATCCCGG + Intergenic
1106229847 13:27813358-27813380 TCCTCTCCTCTATCTCATTCAGG - Intergenic
1106247653 13:27962850-27962872 GCCTCCGCTGGGCTTCATTCCGG - Exonic
1109766472 13:66906589-66906611 GCCTCTCCTGTGTTTCATTCTGG + Intronic
1118693535 14:68362548-68362570 GCCTCTGTTATGTTTCTTTCAGG - Intronic
1120408938 14:84126403-84126425 CCCTCATCTGTGTTTCAGTCAGG - Intergenic
1121601821 14:95210879-95210901 GCCGCTGCTGTTTTTCCTTCAGG - Exonic
1125818251 15:42605123-42605145 CTCTCTCCTGAGTTTTATTCTGG + Intronic
1126391032 15:48152383-48152405 GCTTCTCTAGTGTTTCATTGTGG - Intronic
1127696391 15:61452057-61452079 GCGTTTCCAGTGTTTCATACTGG + Intergenic
1128140842 15:65299928-65299950 GCCTGTACTGTGCTTCACTCTGG - Intronic
1128217525 15:65944767-65944789 GCCTCTCCAGTGTTAAATTCTGG - Intronic
1131847057 15:96499113-96499135 TGCTCTCCAGTTTTTCATTCTGG - Intergenic
1137765287 16:50973273-50973295 GCATCTCCTGTGTTTTCTTGGGG - Intergenic
1138461448 16:57150528-57150550 GACTCTAGTGTCTTTCATTCTGG - Intergenic
1139176511 16:64695807-64695829 GTTTCTCATGTGGTTCATTCGGG - Intergenic
1140029834 16:71326803-71326825 GTCTCTCCTGTCAATCATTCTGG - Intergenic
1140881169 16:79199360-79199382 GCCTCTCCTGTCTTTAACTGGGG + Intronic
1141943436 16:87293842-87293864 TCCTCACCTGTGTCCCATTCAGG + Intronic
1145371810 17:22312390-22312412 GCCTCCCCTCCTTTTCATTCAGG + Intergenic
1145865279 17:28237308-28237330 GCATATCCTGTCTTTCATTTGGG + Intergenic
1146539464 17:33681734-33681756 GCCTCTCCTCTGTGTTATTCTGG + Intronic
1148236793 17:45974456-45974478 CCCTCACCTGTGGTTCCTTCTGG - Exonic
1148466816 17:47870011-47870033 GCCTCACCAGGGCTTCATTCTGG - Intergenic
1149058187 17:52389882-52389904 GTATCTCATTTGTTTCATTCAGG - Intergenic
1149256103 17:54828574-54828596 GCCTCTCCTGTGTCTCCTCTTGG + Intergenic
1149754771 17:59177633-59177655 GCCTCTCCTATGGGTCATTTGGG - Intronic
1154050062 18:10945958-10945980 GTTTTTCCTGTGTTTCATTTTGG - Intronic
1156696943 18:39778790-39778812 GCTTACCCTGTGTTTCTTTCTGG - Intergenic
1159079124 18:63715352-63715374 GGCCCTCCTGTGTAGCATTCTGG - Intronic
1160598747 18:79996303-79996325 GCCACTCCTGTGTCAAATTCAGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1164080602 19:21858708-21858730 GCCTCTCCTCTGTTTCTACCAGG - Intergenic
1164421667 19:28099031-28099053 CCCTCTCCTGCTTTTCTTTCTGG - Intergenic
1165014989 19:32874322-32874344 GCCTACCCTGTGCTTCACTCAGG - Intergenic
1165473547 19:36016864-36016886 CCCTCTCCTATGTGACATTCAGG - Intronic
1165949135 19:39463516-39463538 GCCTAACCTGTGGTTTATTCTGG + Intronic
925019801 2:559332-559354 GCCTCTCCTGGTTTTGACTCAGG - Intergenic
929651662 2:43686004-43686026 CCCTTGCCTGTGTTTGATTCAGG + Intronic
932168587 2:69532320-69532342 GCATCTCCTGTGTTCCACTTGGG - Intronic
933834302 2:86232802-86232824 GCCCCTCCTGTGTTGTATCCAGG - Exonic
936073070 2:109384219-109384241 GGTTCTCCTCTGCTTCATTCAGG - Intronic
936922369 2:117702078-117702100 GCCTCATCAGTGTTTCCTTCTGG + Intergenic
936972436 2:118188099-118188121 GCCTCTCCTGTGGTACACTGGGG + Intergenic
937058052 2:118956081-118956103 GCCTGTACTTTGTTTCATTTTGG - Intronic
939690732 2:145256968-145256990 GCCTCACATGTGATCCATTCTGG - Intergenic
940256689 2:151738563-151738585 CCCTCCACTGTCTTTCATTCTGG + Intergenic
941861807 2:170290117-170290139 GCCTAAGCTGTGATTCATTCTGG + Intronic
942553085 2:177141198-177141220 GCCTCTTCTGTCTGTTATTCGGG - Intergenic
943215394 2:185027085-185027107 GCTTCTCCTATGTTTTCTTCTGG - Intergenic
943914246 2:193607697-193607719 GCCTCTCTTATGTTGCATTATGG + Intergenic
945799647 2:214411573-214411595 GTGTCTGCTGTGTTTCTTTCTGG + Exonic
1169235194 20:3924925-3924947 GCCTCTGCTGTGCTGCGTTCAGG + Intronic
1169926951 20:10793752-10793774 GCCTCTCCATTTTGTCATTCTGG - Intergenic
1170429079 20:16260363-16260385 GCCCCTCCTCTGTTACTTTCTGG + Intergenic
1171797496 20:29577744-29577766 GCCTCTGCCGTGTTTCCTGCTGG - Intergenic
1171850756 20:30306417-30306439 GCCTCTGCTGTGTTTCCTGCTGG + Intergenic
1172633224 20:36392922-36392944 GCTTCTCCCTTGATTCATTCAGG - Intronic
1173320449 20:41982676-41982698 GCCCCTACTGTGTATCATTGGGG + Intergenic
1178825730 21:36014957-36014979 ATTTCTCCTGTGTTTCTTTCTGG - Intergenic
1180884185 22:19228207-19228229 TCCTATCCTTTGTTTCCTTCAGG + Intronic
1184557168 22:45239878-45239900 GCTTCTCCTGGGCTTCAGTCTGG + Intronic
949347762 3:3092635-3092657 GCCACTCCAGTCTTTCAGTCTGG - Intronic
949922757 3:9015815-9015837 GCCTTTCCTGTGGTTCAGGCTGG - Intronic
950853612 3:16085868-16085890 GCCTTTCCTCTGTATTATTCTGG - Intergenic
951145360 3:19220180-19220202 GCCATTGCTGTTTTTCATTCTGG + Intronic
951826016 3:26869601-26869623 CTCTCTTCTGTGTCTCATTCTGG - Intergenic
953832198 3:46309641-46309663 TCCTCTACTGTGTTTCTCTCTGG + Intergenic
954932876 3:54299239-54299261 GCCTCTGCTATGTTTCAGTTAGG - Intronic
962160798 3:132998288-132998310 GCTACACCTGTGTTTGATTCAGG + Intergenic
963764860 3:149324125-149324147 ACCTCTTCTGTATTTCTTTCTGG + Intronic
966979040 3:185113467-185113489 GCCTCACCTGAGGTTTATTCAGG + Intronic
968947369 4:3672287-3672309 GCCACTCCTGGGTGACATTCTGG + Intergenic
969084567 4:4646285-4646307 GGCTCTCCTGTGGATCTTTCCGG + Intergenic
969473206 4:7402024-7402046 GCCTCCCCTGTGGTTAATTTGGG + Intronic
969872228 4:10111712-10111734 GACTCACCTGTGTTTCCTGCGGG - Intronic
971535460 4:27742966-27742988 CATTCTCATGTGTTTCATTCAGG + Intergenic
972993422 4:44850642-44850664 GACTCTCCTGATTTTCATACAGG - Intergenic
976985459 4:91290539-91290561 GCCTCTCCTCTGTACCATACTGG - Intronic
977250225 4:94681199-94681221 GTCTTTCCTTTGTCTCATTCGGG - Intergenic
978723633 4:111944848-111944870 GCCTCTACTCTGGTGCATTCAGG + Intergenic
978730833 4:112024528-112024550 GCTTGTCTTGTGTTTCTTTCTGG - Intergenic
979952926 4:126917232-126917254 GACTCTCCTGTTGTTTATTCAGG + Intergenic
980387214 4:132101785-132101807 GTTTCTCCTGTATTTCATTGAGG - Intergenic
984036640 4:174677177-174677199 TTCTATCCTGGGTTTCATTCTGG - Exonic
985130620 4:186735001-186735023 GTCTCTCCTGTTATTCACTCTGG + Intergenic
986576971 5:9222353-9222375 ACCTCTCCTGTGTTTTGTTAGGG - Intronic
986951576 5:13092855-13092877 GCCTTTCCCCTGTTTTATTCTGG - Intergenic
989610756 5:43288430-43288452 GCCACTTCAGTGTTTCTTTCAGG + Intergenic
991258265 5:64639105-64639127 CCCTTTCCTCTGTTGCATTCTGG - Intergenic
996967555 5:129322944-129322966 CCCTGTCCTGTATATCATTCTGG - Intergenic
998616328 5:143744582-143744604 GAATCTCCTGTGTTTCAATCAGG - Intergenic
999842043 5:155438178-155438200 GCCTCTCCTATTTCTCATTTTGG + Intergenic
999997575 5:157106830-157106852 GCCTGTCCTGTGTTTGAATGTGG - Exonic
1000420133 5:161029237-161029259 GCGTCTCCTGTTTTTCCTTGAGG + Intergenic
1000447037 5:161334789-161334811 TCCTCTCCTGGGTCTCCTTCTGG - Exonic
1009319987 6:62276034-62276056 CCCTCTCCTGAGTTGCAGTCAGG + Intronic
1009412496 6:63382358-63382380 ACCTCACCTGTCTTGCATTCTGG + Intergenic
1012844614 6:104374264-104374286 TCCTCTCCTGTGTTTCCTTGTGG - Intergenic
1013946590 6:115729137-115729159 GCCTCTGCTGTGTGTCACCCAGG + Intergenic
1014538625 6:122647995-122648017 GGATCTCCTGTGTTTCAGACAGG + Intronic
1015600035 6:134902823-134902845 GGCTCTGCTGTGTTTCAGGCTGG - Intergenic
1015924545 6:138295972-138295994 GCCTCTCCTCTGCTTCCTACTGG - Intronic
1016423974 6:143914482-143914504 GCCTAACATGTGGTTCATTCTGG + Intronic
1016856297 6:148673935-148673957 GCCTATCCTATGATCCATTCTGG + Intergenic
1021406605 7:20275283-20275305 GGCACTCCTGAGATTCATTCAGG + Intergenic
1024517038 7:50267912-50267934 GCCTCTCCAGTCTTGCAGTCAGG - Intergenic
1026838031 7:73651086-73651108 GCCTCTCCTGTTTTACATATGGG - Intergenic
1028223343 7:88221363-88221385 GCCTGTTTTGTGTTTGATTCAGG + Intronic
1034426834 7:151018434-151018456 GCCTTTCAGGTCTTTCATTCCGG - Exonic
1034861900 7:154603317-154603339 TCCTCTCTTGTTTTTCCTTCGGG + Intronic
1035833323 8:2722312-2722334 GCCTCTCCTGTTTTTACTGCCGG + Intergenic
1036487689 8:9194434-9194456 GCCTCTCCTCTGTTCCCTGCAGG + Intergenic
1039270682 8:35877031-35877053 CCCTCCCCTGAGTTTCATTTAGG + Intergenic
1041265719 8:56062620-56062642 GCCTAACCTGTGATTTATTCTGG - Intergenic
1041732823 8:61079491-61079513 GGGTCTCCTGTGCCTCATTCAGG + Intronic
1050055862 9:1653608-1653630 GTCCCAGCTGTGTTTCATTCTGG + Intergenic
1051690057 9:19701991-19702013 GAATCTCTTGTTTTTCATTCTGG + Intronic
1052956246 9:34255209-34255231 GCCTCTCCTGGGTAGCTTTCTGG + Intronic
1053265811 9:36712502-36712524 GCCTTTCCTCTGTCTCTTTCTGG + Intergenic
1053799108 9:41753218-41753240 GCCTCCCCTCCTTTTCATTCAGG - Intergenic
1054146106 9:61561780-61561802 GCCTCCCCTCCTTTTCATTCAGG + Intergenic
1054176819 9:61881048-61881070 GCCTCTGCCGTGTTTCCTGCTGG + Intergenic
1054187522 9:61965277-61965299 GCCTCCCCTCCTTTTCATTCAGG - Intergenic
1054465836 9:65492859-65492881 GCCTCCCCTCCTTTTCATTCAGG + Intergenic
1054650995 9:67623303-67623325 GCCTCCCCTCCTTTTCATTCAGG + Intergenic
1055233973 9:74096779-74096801 GTCTCTTCTGTGTTGCATGCAGG - Intergenic
1057109859 9:92458913-92458935 GCCTCTTCTCTTTTTCTTTCCGG - Intronic
1057908526 9:99000852-99000874 CCCCCTCCAGTGTGTCATTCAGG - Exonic
1059721813 9:116967376-116967398 ACCTCTTCTGTGTTTCAAGCAGG + Intronic
1060039021 9:120283798-120283820 GCCTCCCCTATGTGTCATTCAGG - Intergenic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1187497434 X:19807565-19807587 TCCTCTCCTGTGTTTCTTCATGG + Intronic
1189337577 X:40179616-40179638 GACACTCCTGTGGTTCATTTAGG + Intergenic
1190282501 X:48940266-48940288 GCCTCTCCCGTGTATCCTTCAGG - Intronic
1190753678 X:53382664-53382686 GGGTCTCCTGTCTTTCTTTCTGG - Intronic
1191162841 X:57351066-57351088 GCCTATCCTGTGGTTCATATTGG - Intronic
1194746312 X:97632256-97632278 CCCTCTACTGTGTTTCTTCCAGG - Intergenic
1197137786 X:123083143-123083165 GCCTCTCCACTCTTTCCTTCAGG + Intergenic
1197345551 X:125322816-125322838 GCCTCTCCTGATCTTCCTTCTGG - Intergenic
1198624470 X:138554330-138554352 TTCTGTACTGTGTTTCATTCTGG - Intergenic
1199540775 X:148955803-148955825 GCCTCTCCTCAGTCTCATTAGGG + Exonic
1200163606 X:154021203-154021225 GCTCCTCCTGTGTCTCATTCTGG - Intergenic