ID: 1109769690

View in Genome Browser
Species Human (GRCh38)
Location 13:66954651-66954673
Sequence CTTTGTGCCCAGAGCATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109769690_1109769697 25 Left 1109769690 13:66954651-66954673 CCAACTATGCTCTGGGCACAAAG 0: 1
1: 0
2: 0
3: 23
4: 220
Right 1109769697 13:66954699-66954721 CCTCTCACAGACCAAGAATAGGG 0: 1
1: 0
2: 1
3: 8
4: 126
1109769690_1109769695 24 Left 1109769690 13:66954651-66954673 CCAACTATGCTCTGGGCACAAAG 0: 1
1: 0
2: 0
3: 23
4: 220
Right 1109769695 13:66954698-66954720 CCCTCTCACAGACCAAGAATAGG 0: 1
1: 0
2: 1
3: 10
4: 125
1109769690_1109769698 26 Left 1109769690 13:66954651-66954673 CCAACTATGCTCTGGGCACAAAG 0: 1
1: 0
2: 0
3: 23
4: 220
Right 1109769698 13:66954700-66954722 CTCTCACAGACCAAGAATAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109769690 Original CRISPR CTTTGTGCCCAGAGCATAGT TGG (reversed) Intronic
903381024 1:22896896-22896918 CGTGGTGCCCAGCACATAGTAGG + Intronic
903463181 1:23533567-23533589 CTTAGAGCCCAGTGTATAGTAGG - Intergenic
903575484 1:24337218-24337240 CACTGTCCCCAGAGCATAGCAGG + Intronic
903661772 1:24982865-24982887 ATTTGTGCCTAGAACATAGCAGG - Intergenic
905695982 1:39973817-39973839 CTTTGTCCTCAGAGCCTAGTTGG - Intergenic
905758409 1:40532070-40532092 CCTGGTTCCAAGAGCATAGTTGG + Intronic
905924513 1:41740207-41740229 CTTAGGGCCCAGAGCATTGGTGG - Intronic
906341300 1:44983405-44983427 CTTTGTGCCTTGGGTATAGTAGG - Intronic
907701891 1:56796899-56796921 CCTAGTGCCTAGTGCATAGTAGG - Intronic
908025157 1:59942850-59942872 CTCTGTGCCCAGCACATAGTAGG - Intergenic
908389924 1:63675197-63675219 CACTGTGCCTGGAGCATAGTGGG + Intergenic
908420319 1:63952713-63952735 CTGAGTGCCCTGAGAATAGTGGG + Intronic
910191700 1:84601923-84601945 CTGGGAGGCCAGAGCATAGTGGG - Intergenic
911118542 1:94271902-94271924 CTTTGTGTCCAGAGGCAAGTAGG + Intronic
912728545 1:112080702-112080724 CAAAGTGCCCAGAACATAGTAGG + Intergenic
914978203 1:152386923-152386945 CTGTGTGCCCAGAACTAAGTAGG + Intergenic
916792797 1:168138020-168138042 ATTTGTCCCCAGAGCAATGTGGG - Intergenic
917596091 1:176530494-176530516 CTTTGTGCCTAGAGAACACTTGG + Intronic
918576374 1:186065615-186065637 CACTGTGCCTAGAACATAGTAGG - Intronic
919816626 1:201444933-201444955 CTTTGTGGTCAGACCATAGGAGG + Intergenic
921828205 1:219697997-219698019 CTGTGTGGCAAGGGCATAGTAGG + Intronic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
1064679941 10:17800598-17800620 CATAGTGCCCAGAACATAGTAGG - Exonic
1064825907 10:19400514-19400536 CTTAGTGCCTAGCACATAGTAGG + Intronic
1066400366 10:35070251-35070273 TTCAGTGCCCAGAACATAGTTGG + Intronic
1066644334 10:37590473-37590495 CTCAGAGCCCAGAACATAGTAGG - Intergenic
1067016560 10:42760222-42760244 CTTTGTGACCAGAGCCCAGTTGG - Intergenic
1067450242 10:46377624-46377646 CTTTGTGCCTAGAGGACACTGGG - Intronic
1067587000 10:47482139-47482161 CTTTGTGCCTAGAGGACACTGGG + Intronic
1067634060 10:47989906-47989928 CTTTGTGCCTAGAGGACACTGGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1071436672 10:85653988-85654010 CTTTGTATCCAAAGCCTAGTCGG + Intronic
1071562728 10:86656216-86656238 CACTGTGCCCAGGGTATAGTGGG - Exonic
1072686791 10:97542377-97542399 CTTTGTGCCCAGAGCAGCTGGGG + Intronic
1072860148 10:98994941-98994963 CTTTGGGCCAAGACCTTAGTGGG + Intronic
1079714100 11:23722630-23722652 CCTGGAGCACAGAGCATAGTAGG + Intergenic
1081730199 11:45366542-45366564 TTTTGTGACCAGAGAATGGTTGG + Intergenic
1083311351 11:61785505-61785527 TGATGTGCCCAGAGCATAGTGGG + Intronic
1084602281 11:70152929-70152951 CTTTGGGTCCAGTTCATAGTTGG - Intronic
1085606229 11:77901858-77901880 ATTTGTTCCCACAGCAGAGTGGG - Intronic
1085845810 11:80063360-80063382 CTTTGTGATGAGTGCATAGTTGG - Intergenic
1088879690 11:113963709-113963731 GTTTGTGCCCAGAGAAGAGAAGG + Intergenic
1089498591 11:118919998-118920020 CTCTGGTCCCAGAGCACAGTGGG - Intronic
1090479748 11:127057641-127057663 CTTTGGGCCCAGGTCATTGTTGG + Intergenic
1092648077 12:10601444-10601466 CTTTGTGGCAAGAGCCTTGTTGG - Intergenic
1094002999 12:25716455-25716477 TTTTGTGCCTAGAGCATTGTAGG - Intergenic
1098033055 12:66273920-66273942 CTTTTTGCCCAGAACATTATAGG - Intergenic
1098087089 12:66857644-66857666 CTCAGTGCCTAGAGCATAGATGG - Intergenic
1101233314 12:102764012-102764034 CATTGTGCGCAGAACACAGTAGG - Intergenic
1101406325 12:104432416-104432438 CGTTATGCCTAGAGCAGAGTTGG + Intergenic
1101646457 12:106634961-106634983 CTTTCTCCCCAGTGCCTAGTTGG + Intronic
1101949077 12:109160417-109160439 CCCTGTGCCCAGTCCATAGTGGG + Intronic
1103136334 12:118511014-118511036 CCTTGTGCCTGGTGCATAGTAGG + Intergenic
1107085304 13:36421126-36421148 CATAGTGCTCAGAACATAGTAGG - Intergenic
1109769690 13:66954651-66954673 CTTTGTGCCCAGAGCATAGTTGG - Intronic
1111928271 13:94485977-94485999 CTTAGTGCCTGGAGCATAGTAGG - Intergenic
1113588778 13:111483631-111483653 CAATGTGCCCAGCACATAGTAGG + Intergenic
1116236674 14:42287090-42287112 CTGTGAGCCAAGAGGATAGTGGG - Intergenic
1116443038 14:44976475-44976497 CAATGTGCTCAGAGTATAGTGGG - Intronic
1119757286 14:77128022-77128044 CTTTGGGCCCAGAGAAGACTAGG + Intronic
1121991178 14:98559196-98559218 CTGTGTGCTCAGAGAAAAGTGGG + Intergenic
1122082575 14:99275390-99275412 CTTTGGGCCCAGCACACAGTAGG - Intergenic
1127064095 15:55219111-55219133 CTTTATTCACAGAGGATAGTTGG - Intronic
1127159193 15:56163497-56163519 GATAGTGCCTAGAGCATAGTAGG - Intronic
1128069729 15:64787361-64787383 CTTTGTGCCCAGCACACAGCTGG - Intergenic
1129247722 15:74289946-74289968 CTGTGAGCCCAGTGCATAATTGG + Intronic
1129256861 15:74338730-74338752 CTCTCGGCCCAGAGCATAGATGG + Exonic
1129836391 15:78709970-78709992 CTCTGTGCCCAGTACACAGTAGG - Intronic
1130214412 15:81954682-81954704 CACTGTGCCCAGAGCATCATAGG - Intergenic
1131150819 15:90046271-90046293 CTCAGTGCCCAGCCCATAGTAGG + Intronic
1131400395 15:92120719-92120741 CTGTAGGCCCAGAGCAGAGTGGG - Intronic
1131795816 15:96015814-96015836 CTTTGTGTCCAGAGTAAACTAGG - Intergenic
1131961511 15:97794185-97794207 CCTTGTGCCCAGAGCCAAGTTGG + Intergenic
1132091053 15:98948265-98948287 CTTTGAACGCAGAGCATACTGGG - Intronic
1133847236 16:9466743-9466765 TCTTATGCCTAGAGCATAGTAGG + Intergenic
1135641707 16:24125364-24125386 TGTTGTGGCCAGAGCACAGTGGG - Intronic
1136178922 16:28537835-28537857 CCTAGTGGCCAGAGCAAAGTGGG - Intronic
1136463745 16:30428260-30428282 CCAAGTGCCCAGCGCATAGTAGG - Intronic
1136513486 16:30753681-30753703 CTTTGCGCCCACAGGATACTTGG - Intronic
1137334403 16:47533640-47533662 CTTTGCTCCAAGATCATAGTGGG + Intronic
1137627760 16:49920388-49920410 CTCAGTGCCCAGCACATAGTAGG - Intergenic
1139594991 16:67952210-67952232 CTTTATGCCCCCAGCATAGATGG + Exonic
1142115959 16:88356189-88356211 CTCTGTGCCCAGAGCCGAGGAGG - Intergenic
1142290552 16:89192065-89192087 CATTGTGCCCAGAGGACGGTGGG + Intronic
1142727447 17:1826638-1826660 CTTTGTGCCAGGCACATAGTAGG - Intronic
1143573453 17:7775908-7775930 CTTTGTACCCAGAGAAAAGCGGG - Intronic
1146513661 17:33472358-33472380 CAATGTGCCCAGTGCATGGTGGG - Intronic
1146761465 17:35482689-35482711 CTTTGCTCCCAGATCAGAGTGGG - Intronic
1147798249 17:43061462-43061484 CCTAGTGCCCAGAACACAGTAGG + Intronic
1148203907 17:45767757-45767779 CAGTGTGCCCAGCACATAGTAGG + Intergenic
1148218028 17:45844649-45844671 CTCTCTGCCCAGACCCTAGTGGG - Intergenic
1148858442 17:50591725-50591747 CCTTGTGCCCACAGCATCCTGGG + Exonic
1149440475 17:56669612-56669634 GTTTGTGCCCAGCACATGGTAGG + Intergenic
1149480669 17:57000774-57000796 CTTTCAGCCCAGAGCATCTTGGG - Intronic
1152246945 17:79189777-79189799 CCTTGTGCCCAGACCATAGATGG + Intronic
1153560917 18:6370942-6370964 TTCTGTGCACAGAGCATTGTGGG + Intronic
1154073534 18:11177414-11177436 CTGTGTACCCAGAACATAGTAGG + Intergenic
1154245391 18:12692439-12692461 CTGTGTGGCTAGAGCGTAGTGGG - Intronic
1154940188 18:21104790-21104812 CTTTGTGCCAAGGGTTTAGTTGG - Intronic
1159023535 18:63162675-63162697 AATTGTGCCAAGAGCATAGATGG - Intronic
1160354302 18:78214084-78214106 CTCTGAGCCTAGAGCATAATGGG - Intergenic
1161767856 19:6216821-6216843 CTCTGTGCCCCGAGCAGAGGAGG - Intronic
1161778504 19:6276888-6276910 CTGGGAGCCCAGAGCACAGTGGG + Intronic
1164732744 19:30518728-30518750 CTAGGTGCCCAGCACATAGTAGG - Intronic
1164824607 19:31275843-31275865 GCTTATGCCCAGAGCATAGCAGG + Exonic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
1168335858 19:55597486-55597508 CCTTTTGCCCAGAGTACAGTGGG + Intronic
927683663 2:25156255-25156277 CTGTGTGCCCACAGCAGAGATGG - Exonic
927719622 2:25374187-25374209 CTTCGTGCCCAGCACACAGTTGG + Intergenic
928420771 2:31136854-31136876 CTGTGTGCCAGGTGCATAGTAGG - Intronic
929644096 2:43610098-43610120 CACAGTGCCCAGAACATAGTAGG - Intergenic
931123387 2:59245986-59246008 GTTTGTTACCATAGCATAGTCGG + Intergenic
931588094 2:63850857-63850879 CTGTATACCCAGAGCATAGCTGG + Intronic
931609725 2:64085869-64085891 CTTTGTTCCCATAGAATGGTAGG + Intergenic
931649795 2:64457040-64457062 CTTCCTGCCCAGAAGATAGTGGG - Intronic
932007562 2:67942003-67942025 CTTTTGGCCCAGAGTATAGATGG + Intergenic
932376799 2:71243666-71243688 TTTGGTTCCCAGAGTATAGTGGG - Intergenic
940367127 2:152860685-152860707 CTGTGTACCCAGTGCATAGCTGG - Intergenic
940533961 2:154914634-154914656 ACTTTTGCACAGAGCATAGTAGG - Intergenic
940660684 2:156541473-156541495 CTTAGTGCCTGGTGCATAGTGGG + Intronic
943666507 2:190615015-190615037 CTGTGTGTTGAGAGCATAGTAGG - Intergenic
945043878 2:205764918-205764940 CCTTATGTCCAGGGCATAGTAGG + Intronic
946334242 2:219027035-219027057 CTTGGGGCCCAGAGAAAAGTAGG - Intronic
947796650 2:232897283-232897305 ATTTGTTCCCAGAACACAGTGGG + Intronic
1168860216 20:1040835-1040857 GTTTTTGCTCAGAGCACAGTGGG - Intergenic
1169545897 20:6650334-6650356 GTTGCTGCCCAGAGCATGGTTGG - Intergenic
1169627512 20:7588792-7588814 CTGTGTGCCTAGAACATAGTAGG - Intergenic
1169728974 20:8766154-8766176 CTGTGTCCCCAGGGCACAGTAGG - Intronic
1172838293 20:37886849-37886871 CTTTGTCCCCAGAGTCTAGCAGG - Intergenic
1173464536 20:43270576-43270598 CACTGTGCCCAGCTCATAGTAGG + Intergenic
1173579468 20:44137086-44137108 CATTGTGCCCAGCACATAGTAGG + Intronic
1175034086 20:55983363-55983385 CTTTGTGCCTAGAGATAAGTGGG + Intergenic
1175242165 20:57557660-57557682 CCTTGTGCTCAGACCCTAGTCGG + Intergenic
1175627171 20:60499196-60499218 AAATATGCCCAGAGCATAGTAGG + Intergenic
1175871454 20:62211278-62211300 CCTGGTGCCCAGAACACAGTAGG + Intergenic
1177078434 21:16607984-16608006 CCTAGTGCCCAGAACCTAGTAGG + Intergenic
1178726929 21:35061581-35061603 CTTAGTGACCAAAGCATAGAGGG + Intronic
1179164303 21:38923989-38924011 CTTTCTGCCCAGACTATAGAGGG - Intergenic
1183078192 22:35439869-35439891 CATGGTGCCCAAAGCAGAGTGGG + Intergenic
1183372853 22:37444778-37444800 CTGTGTTCCCAGCGCGTAGTAGG - Intergenic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
949366058 3:3281927-3281949 CACTGGGGCCAGAGCATAGTAGG + Intergenic
951663268 3:25094345-25094367 CTATTTGCCCAGGACATAGTAGG - Intergenic
952339107 3:32430497-32430519 CCTAGTGCCCAGCACATAGTAGG - Intronic
955065261 3:55528481-55528503 CTCAGTGCCCAGCACATAGTAGG - Intronic
955397792 3:58569403-58569425 CTCAGTGCCCAGCACATAGTAGG + Intronic
956161476 3:66357994-66358016 CATAGTGCCTAGAGCATTGTAGG + Intronic
956381735 3:68671260-68671282 CTTTGTGCACAGTGCATTCTGGG - Intergenic
957246406 3:77722085-77722107 CTTAGTTCCCAGCACATAGTAGG + Intergenic
957585751 3:82129551-82129573 TTTTGTGCCCAGACTATACTAGG + Intergenic
960240532 3:115336316-115336338 CATACTGCCCAGAACATAGTAGG - Intergenic
960441006 3:117688986-117689008 CTTTGATTCCATAGCATAGTGGG - Intergenic
961633715 3:128319819-128319841 CTGTGTGCCCAGAACATAATAGG + Intronic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
963842778 3:150124595-150124617 CTTTCTGCAAATAGCATAGTGGG + Intergenic
964667330 3:159188798-159188820 CAATGTGCCCAGCTCATAGTAGG + Intronic
966398862 3:179527339-179527361 CGTTGTGCCCAGAATACAGTTGG + Intergenic
968437389 4:600991-601013 ATTTCTGGCCAGAGCAAAGTTGG - Intergenic
969367927 4:6710272-6710294 ATTTGAGCCCAGAGCAATGTGGG + Intergenic
969440376 4:7213353-7213375 CTTTGTGTCCAGGGCATGGAGGG + Intronic
971236243 4:24844815-24844837 CTTTGGGCCCAGGGCACTGTGGG - Intronic
972358344 4:38303504-38303526 CTTTGTTCCAAGATCACAGTGGG + Intergenic
975544972 4:75551031-75551053 CATTGTGCCAACATCATAGTAGG + Intergenic
975578915 4:75889675-75889697 CTCAGTGCCCAGAGCAATGTGGG + Intronic
976871491 4:89799365-89799387 CATTGTCACCAGAGCATAGCAGG - Intronic
977437352 4:97015283-97015305 CTTTATGCCAAGGGCATAGAAGG - Intergenic
978857363 4:113408432-113408454 CTATGGGCCCAGAGCAGAGTGGG - Intergenic
979575459 4:122286148-122286170 CTTTATTCACAGAGAATAGTAGG - Intronic
980463232 4:133145771-133145793 CTATGTGCCCAGAGCTTTGAGGG - Intergenic
981515244 4:145600948-145600970 CTTTGTCCCCAGAAAATAGTTGG - Intergenic
982166197 4:152615656-152615678 CTCTGTGCCTGGTGCATAGTAGG + Intergenic
986891287 5:12310350-12310372 ATTTGTGCCAGGAGGATAGTGGG - Intergenic
991476559 5:67027327-67027349 CTTTGCTTCCACAGCATAGTTGG - Intronic
991970341 5:72135004-72135026 CTTTGAGCCCAGAGCTGAGTTGG + Intronic
997892587 5:137688211-137688233 CCTAGTGTGCAGAGCATAGTGGG + Intronic
999552374 5:152703431-152703453 CTTTATGCCCATAGCATAATAGG - Intergenic
1000241272 5:159410653-159410675 CTATGTGCCTAGTACATAGTAGG + Intergenic
1001564106 5:172688491-172688513 CTGGGTGCCCAGAGCAAAGCTGG + Exonic
1001779949 5:174359634-174359656 CCAGGTGCCCAGAGCAGAGTAGG - Intergenic
1001844491 5:174910020-174910042 CTCTGTGCCCAGCACACAGTAGG + Intergenic
1001858413 5:175032588-175032610 CGTTGTGCCTAGCACATAGTAGG + Intergenic
1002569126 5:180130055-180130077 CTGTGTGCCCAGAGCAGGGCTGG + Intronic
1002714818 5:181220277-181220299 CTTTGTGCCCGGAGCAGCTTGGG + Intergenic
1003311767 6:4975151-4975173 CTTTGTGCACAGGGCTTTGTGGG - Intergenic
1003579184 6:7324117-7324139 GTTTGGGCCCAGAGCATGGAAGG + Intronic
1004016131 6:11733555-11733577 CTGTGTGCCCATAGCATCCTGGG + Intronic
1008247614 6:49197481-49197503 CTTTCTGCCCAGGACATAGTAGG + Intergenic
1008541322 6:52548870-52548892 CTTTGTGCCAAGAACACTGTGGG - Intronic
1008822059 6:55644850-55644872 CTTTTTGCTCATAGCATAGTTGG + Intergenic
1011986940 6:93458950-93458972 ATCAGTGCCCAGAACATAGTAGG + Intergenic
1013166732 6:107600834-107600856 TTTTGTGCCCTGCACATAGTAGG - Intronic
1013281428 6:108640846-108640868 AATTGTGCCCAGCACATAGTAGG - Intronic
1014197225 6:118574704-118574726 CTCTGTGCACAGACCAAAGTAGG + Intronic
1016492219 6:144618679-144618701 CATTGTGCCAAGTACATAGTAGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018454936 6:163943484-163943506 CCATGTGCCCAGAGCATTTTAGG + Intergenic
1019897971 7:3997882-3997904 CTTTGCCCCCAGATCAGAGTGGG + Intronic
1019918951 7:4150703-4150725 CTTTGCCCCCAGGGCAGAGTGGG - Intronic
1020650408 7:10868228-10868250 CATAGTGCCGAGAACATAGTGGG + Intergenic
1022494279 7:30843553-30843575 CCTTGTGCCCTGAGCAGAGTCGG - Intronic
1023572068 7:41582614-41582636 CTTTGTTCCAAGAGCAAAGAAGG - Intergenic
1025846386 7:65202178-65202200 ATTTGTTCCCACAGCAGAGTGGG + Intergenic
1025896632 7:65708085-65708107 ATTTGTTCCCACAGCAGAGTGGG + Intergenic
1026831662 7:73614014-73614036 CTTGGTGCCCACAGCTTAGTGGG + Intronic
1027233736 7:76286075-76286097 CTTTGTTCCCCGGGCACAGTGGG - Exonic
1028384612 7:90241049-90241071 CTTTGTTCCCAAATAATAGTGGG - Intergenic
1029709261 7:102290637-102290659 CGTGGTGGCCAGAGCATGGTGGG + Intronic
1033168942 7:139066438-139066460 ATTTGTACCCAGGGCAAAGTGGG + Intronic
1035384285 7:158459877-158459899 CTGTGTGCCGAGAGCACAGGAGG + Intronic
1035384351 7:158460315-158460337 CTGTGTGCCAAGAGCACAGGAGG + Intronic
1036458733 8:8932538-8932560 CTTTGTGGCCATAGCAGCGTTGG + Intergenic
1040360503 8:46659753-46659775 CATTGTTACCACAGCATAGTTGG - Intergenic
1041436674 8:57849262-57849284 CTTTGCACACAGAGCAGAGTCGG + Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1047317972 8:123752101-123752123 CATAGTGCCCAGAACATAGTAGG - Intergenic
1047975022 8:130121435-130121457 CTTTGCCCCCAGAGGATACTTGG - Intronic
1048221348 8:132545062-132545084 CTTTATGCCTAGTGCATAGCTGG + Intergenic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048295335 8:133209718-133209740 CACTGTGCCCAGAACAGAGTTGG - Intronic
1048354356 8:133641285-133641307 CTTTGTGCCCAGGACAGAGCTGG + Intergenic
1048509633 8:135050528-135050550 CTTTGTGGCCTGAGCACAGAAGG + Intergenic
1048559289 8:135515501-135515523 CTCTGGGCACAGAGCAGAGTAGG - Intronic
1049756086 8:144311886-144311908 CTGTGGGCCCAGGGCAGAGTTGG + Intronic
1050852956 9:10311593-10311615 CTTGGTGCCCAACACATAGTAGG - Intronic
1054978152 9:71172188-71172210 CACTGTGCCCAGCGCATAGAAGG + Intronic
1055145936 9:72934718-72934740 CTTAGTGCCTGGAGCTTAGTAGG - Intronic
1056238419 9:84619083-84619105 CCTTGTCCCCAGAGCAGAGAAGG - Intergenic
1056991412 9:91415077-91415099 CCTTGTGCCCAGTACACAGTAGG - Intronic
1057422579 9:94924264-94924286 ATTTGTGCCTAGTGCATAGTAGG - Intronic
1057747182 9:97761710-97761732 AACAGTGCCCAGAGCATAGTAGG - Intergenic
1058779789 9:108321314-108321336 AGTAGTGCCCAGTGCATAGTAGG - Intergenic
1058907922 9:109496830-109496852 CTTTGTGTCCTGGGCATTGTAGG - Intronic
1059493710 9:114691758-114691780 CTTTTTGCCCTGAGCAAGGTGGG - Intergenic
1059525738 9:114989494-114989516 CATTGTGCCATGAGCATACTTGG + Intergenic
1059751561 9:117252550-117252572 CCTTGTGCAAAGAACATAGTTGG - Intronic
1061620615 9:131809167-131809189 CTATGTGCACAGCACATAGTAGG + Intergenic
1187100722 X:16188396-16188418 CTTTGTGGCCAAAGCACTGTAGG + Intergenic
1192083742 X:68073482-68073504 TTCTGTGCCTTGAGCATAGTAGG - Intronic
1196746743 X:119077936-119077958 CTTTGTTACCTGAGCACAGTAGG + Intergenic
1199092254 X:143705672-143705694 CTTTGTTCCAAGATCAGAGTGGG - Intergenic
1199503657 X:148537379-148537401 CTTGGTGCCCAGCACATAGAAGG - Intronic
1199571729 X:149273321-149273343 AATAGTGCCCAGTGCATAGTTGG + Intergenic
1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG + Intergenic
1201610375 Y:15836226-15836248 CTTTGTGCCCATAGAGCAGTGGG - Intergenic