ID: 1109777119

View in Genome Browser
Species Human (GRCh38)
Location 13:67055689-67055711
Sequence TACTCAGGAGCTGAAGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 1, 1: 2, 2: 34, 3: 145, 4: 535}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109777114_1109777119 -9 Left 1109777114 13:67055675-67055697 CCTGTAGTCCCAGCTACTCAGGA 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
Right 1109777119 13:67055689-67055711 TACTCAGGAGCTGAAGTGGCGGG 0: 1
1: 2
2: 34
3: 145
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109777119 Original CRISPR TACTCAGGAGCTGAAGTGGC GGG Intronic
900296552 1:1954672-1954694 TACTCAGGAGCTGAGGCAGGAGG + Intronic
900663452 1:3797957-3797979 TACTCAGGGGCTGAGGTGGGAGG - Intergenic
901310938 1:8269290-8269312 TACTCCGGGGCTGAGGTGGAAGG - Intergenic
901483770 1:9543658-9543680 TACTCAGTACCTGAAATAGCTGG + Intronic
902328309 1:15717139-15717161 TACTCAGGGGCTGAGGTGGGAGG + Intronic
902553352 1:17232347-17232369 TCCTCAGGGGGTGAAGTGGGAGG - Intronic
902898768 1:19498772-19498794 TACTCAGGGGCTGAGGTGGGAGG - Intergenic
903240694 1:21980906-21980928 AACTCACGAGATGCAGTGGCCGG - Exonic
903244436 1:22005529-22005551 AACTCACGAGATGCAGTGGCCGG - Exonic
903886784 1:26545611-26545633 TGCTCAGCAGCTGCATTGGCAGG + Intronic
904681163 1:32230341-32230363 TACTCAGAAGCTGAGGTAGAAGG - Intronic
904825626 1:33272062-33272084 TCCTGAGGAGCTGAATTGGTGGG + Intronic
905428450 1:37902872-37902894 TACTCAGGAGGTGAAGGGGGAGG + Intronic
905656239 1:39687792-39687814 TGCTCAGAAGCTGAGGTGGGAGG + Intronic
907002363 1:50874468-50874490 TACTTGGGAGCTGAGGTGGGAGG - Intronic
907059123 1:51403145-51403167 TACTCAGGAGGTGAAGTAGGTGG - Intronic
907203748 1:52751087-52751109 TACTCAGGAGCTGAAGTGGGAGG - Intronic
908358207 1:63342899-63342921 TACTCAGGAGGCCAAGTGGGAGG - Intergenic
908523995 1:64970024-64970046 TACTCAGGAGTCGAGGTGGAAGG + Intergenic
909237808 1:73175875-73175897 TACTCAGGAGTGGAGGTGGGAGG - Intergenic
909488257 1:76198144-76198166 TACTTGGGGGCTGAAGTGGGAGG - Intronic
909899037 1:81109674-81109696 GACTCTGGAGCTGAAGAGGGAGG - Intergenic
910755267 1:90683267-90683289 TACTCAGAGACTGAAGTGGGAGG + Intergenic
910842108 1:91570822-91570844 TACTCAGGAGGTTGAGTGGGAGG + Intergenic
910953688 1:92678420-92678442 TACTCAGAGGCTGAGGTGGGAGG + Intronic
911044797 1:93619517-93619539 AACCCAGGAGCTGAGATGGCAGG - Intronic
911053451 1:93691643-93691665 CACCCAGGAGCAGAAGGGGCAGG + Intronic
911337233 1:96595707-96595729 TGCTCAGGGGCTGAAGTGGGAGG - Intergenic
912918488 1:113842098-113842120 TACTCAGGAGCTGAGGTGGGAGG + Intronic
913014754 1:114721696-114721718 GACTCAGGAGCTGAGGTGGGAGG - Intronic
914238124 1:145830988-145831010 TACTCAGGGGCTGAGGTGGGAGG + Intronic
914735316 1:150410969-150410991 TACTCAGAGGCTGACGTGGGAGG - Intronic
915506663 1:156361326-156361348 TACTTGGGGGCTGAGGTGGCAGG + Intronic
916294182 1:163198738-163198760 TATTCAGGAGCTGAGGTGAGAGG - Intronic
917128617 1:171715890-171715912 TACTCAGGAGCTGAGGTGGAAGG + Intronic
917330677 1:173877488-173877510 TACTCAGGAGCTGAGGTGAGGGG - Intronic
917752361 1:178065562-178065584 TACTCAGGAGCTGAGGTGAGAGG + Intergenic
917791943 1:178504575-178504597 TGCTCAGGAGATGAAGTGACGGG + Intergenic
917844796 1:179011564-179011586 TACTCAGAGGCTGAAGTAGGAGG + Intergenic
918103082 1:181393564-181393586 TACTCAGGAAGTGAGGTGGGAGG - Intergenic
919035640 1:192304937-192304959 TACGCAGGAGATGAGGTGGGAGG + Intergenic
919619115 1:199845420-199845442 TACTCAGAAGCTGATGTGGGAGG - Intergenic
919620796 1:199862225-199862247 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
920420375 1:205829137-205829159 AACTCAGGAGCTGAGGTGGGAGG - Intronic
921246324 1:213245525-213245547 TTCCCAGGAGGTGAAGTGGCAGG - Intronic
921878170 1:220223154-220223176 TACTCAGGGGCTGAGGTGGGAGG - Intronic
923169519 1:231400938-231400960 TACTCAGGAGCTGAGATGGGAGG + Intronic
923171129 1:231418751-231418773 TACTCGGAAGCTGAGATGGCAGG + Intronic
923240270 1:232077831-232077853 TACTCAGGATTTGAAATGGGAGG + Intergenic
923275625 1:232393269-232393291 TACTCAGGAGAGGAAGTGCACGG - Intergenic
923391294 1:233515939-233515961 TCCACAGGGGCTGAGGTGGCAGG - Intergenic
923743346 1:236676625-236676647 AACTCAGGGGCTGAGGTGGGAGG - Intergenic
923909343 1:238422896-238422918 TACTCTGGGGCTGAGGTGGGAGG - Intergenic
924019288 1:239763980-239764002 TGCTCAGGAGCTGAGGTGGGAGG + Intronic
924103609 1:240629126-240629148 TACTCAGGAGTTTGAGTGGGAGG - Intergenic
924395276 1:243612215-243612237 TACTGAGGAGCTGAGGCGGGAGG - Intronic
924471721 1:244348817-244348839 TACTCAGGAGGCCAAGTGGCAGG - Intergenic
924642545 1:245848211-245848233 TACTCAGAGGCTGAGGTGGAAGG - Intronic
924665209 1:246064070-246064092 TACTCAGGAGCAAAATTGACAGG - Intronic
1062794209 10:330919-330941 TACTCAGGGACTGAGGTGGGAGG - Intronic
1063510812 10:6643505-6643527 TACTCGGGGGCTGACGTGGGAGG - Intergenic
1063564931 10:7164275-7164297 TACTCAGAGGCTGAGGTGGGAGG + Intronic
1063710569 10:8473857-8473879 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
1064541357 10:16408606-16408628 CACACAGGAACTGAAGTGCCAGG - Intergenic
1064760329 10:18612311-18612333 TACTCAGAGGCTGAAGTAGGAGG + Intronic
1064917126 10:20471760-20471782 TACTCAGTGGCTGAGGTGGGAGG + Intergenic
1064987034 10:21221043-21221065 TAGTCAGGAGCTGAGGTGGGAGG + Intergenic
1064999502 10:21324890-21324912 TACTAAGAAGCTGAGGTGGAAGG + Intergenic
1065458106 10:25928617-25928639 TACTCAGAGGCTGAGGTGGCAGG - Intergenic
1066405850 10:35117343-35117365 TACTCGAGAGCTGAGGTGGGAGG - Intergenic
1066508918 10:36073748-36073770 TACTCAAGAGGTGAGGTGGGAGG - Intergenic
1067667684 10:48292090-48292112 TACTTGGGAGCTGAGGTGGGAGG - Intergenic
1068236996 10:54250018-54250040 TACTCTGGTGCTGAAGTGGGAGG - Intronic
1068672870 10:59741786-59741808 TACTCAGGAGCTGAGGAGGGAGG - Intergenic
1068869951 10:61932517-61932539 TACTCAGGGGCTGAGGTGGAAGG - Intronic
1069018576 10:63460408-63460430 TATTCAGGAGGTGAGGTGGGAGG + Intronic
1070947757 10:80407732-80407754 TACTCTGGAGCTGAGGTGGGAGG - Intergenic
1071297568 10:84233276-84233298 TACTCAGGAGCTGAGGTGGGAGG - Intronic
1071525383 10:86355264-86355286 TGTCCAGGAGCTGAAGAGGCGGG - Intronic
1072527006 10:96281096-96281118 TACTCAGGTGCTGAGGTGGGAGG - Intergenic
1072553987 10:96500675-96500697 TACTCAGGAGGTTAAGTGGGAGG + Intronic
1073235141 10:102008001-102008023 TTCTCAAGAGCTGATGTGGGAGG - Intronic
1073309324 10:102528459-102528481 TACTCAGTGGCTGAGGTGGGAGG + Intronic
1073405108 10:103290669-103290691 TACTGGGGAGCTGAGGTGGGAGG + Intergenic
1073457151 10:103644475-103644497 TACTCGGGGGCTGAGGTGGGAGG + Intronic
1073701715 10:105934938-105934960 AACGCTGGAGCTGAAGTGGCTGG - Intergenic
1075580900 10:123617596-123617618 TAGTCCTGTGCTGAAGTGGCAGG + Intergenic
1077021717 11:419993-420015 AACCCAGGAGGTGGAGTGGCTGG - Intronic
1077063841 11:629738-629760 TACTCAGGAGCTGAAGGGATGGG - Intergenic
1077237861 11:1490794-1490816 AACTGAGGAGCTGAAGTGAGAGG + Intronic
1077415171 11:2421384-2421406 TGCTCAGCAGCAGAACTGGCTGG + Intronic
1077652981 11:3991277-3991299 TACTCAGAAGCTGAGGTGGGAGG - Intronic
1078147432 11:8731095-8731117 CACCCGGGAGCTGGAGTGGCTGG + Exonic
1078436053 11:11326911-11326933 TCCTCATGAGCTGAAGAGGATGG - Intronic
1078982391 11:16551239-16551261 TACTCAAGAGCTGAGGTGGGAGG + Intronic
1080328617 11:31109225-31109247 TACTCGGGGGCTGAGGTGGGGGG - Intronic
1080588631 11:33702338-33702360 CACTCAGGAGCTGAAGTGGGAGG + Intronic
1080869118 11:36221555-36221577 TACTCAGAGGCTTAGGTGGCAGG + Intronic
1081396767 11:42595432-42595454 TGCTCATGAGCTGTAATGGCAGG + Intergenic
1081521724 11:43888199-43888221 TACTCGGAGGCTGAAGTGGGAGG - Intronic
1083170458 11:60921309-60921331 TACTTGGGAGCTGAGGTGGGAGG + Intronic
1083941227 11:65896946-65896968 CAGTCAGGAGCTGCAGTGGATGG - Exonic
1084198808 11:67541724-67541746 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1084206749 11:67599037-67599059 TACTTTGGAGCTGAGGTGGGAGG + Intergenic
1084306551 11:68288479-68288501 TACTCAGGAGCTGAGGTAGGAGG + Intergenic
1084622152 11:70280015-70280037 TACTCAGGAGCTGAGGTGGGAGG - Intronic
1084911196 11:72390789-72390811 TACTCAGGAGCAGAAGTGCTTGG - Intronic
1084975352 11:72794152-72794174 TTCTCAGGAGCTCAAGAGTCAGG + Intergenic
1085405368 11:76258554-76258576 TGCTCAGGGGCTGATGGGGCTGG + Intergenic
1085420350 11:76353128-76353150 TACTTTGGAGCTGAGGTGGGAGG - Intronic
1086342631 11:85861897-85861919 TACTCTGGAGGTGATGTGGGAGG + Intronic
1086571650 11:88291687-88291709 GACTCTGGAGCTGTAGTGCCTGG - Intergenic
1087239645 11:95760598-95760620 TACTCAGGAGCTGAGGCAGGAGG + Intergenic
1087840796 11:102919019-102919041 TACTCAGGAGCTGAGGCAGGAGG + Intergenic
1088048644 11:105483496-105483518 TACTCTGGGGCTGAGGTGGGAGG - Intergenic
1089078221 11:115756040-115756062 TACTCAGGAGTTGAGGCGGAAGG - Intergenic
1089203884 11:116742563-116742585 TACTCAAGAGGTCAAGTGGGAGG - Intergenic
1089304786 11:117519709-117519731 TACTCAGGAGCTGAGGCAGGAGG + Intronic
1089756883 11:120693836-120693858 AACTCAGGGGCTGAAGATGCTGG - Intronic
1089961464 11:122620771-122620793 TACTCAGGAAGTGAGGTGGGAGG + Intergenic
1090060167 11:123457822-123457844 TACTCAGAAGCTGAGGTAGGAGG - Intergenic
1091478277 12:799230-799252 TACTCAGGAGGTGAGGTGGGAGG - Intronic
1092087383 12:5774355-5774377 TACTCAGAGGCTGAGGTGGGAGG + Intronic
1092603256 12:10090358-10090380 TCCTCAGGAGCTGAGGTGGGAGG - Intronic
1093522301 12:20065561-20065583 TACTCAGAAGCTGAGGTGGGAGG + Intergenic
1095424045 12:42056146-42056168 TACTCAGGAGCTGAGGTGGGAGG - Intergenic
1095590118 12:43893844-43893866 GACTCATCAGCTGAAGTAGCTGG + Intronic
1096138326 12:49221289-49221311 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1096529315 12:52233301-52233323 TACCGGGGAGCTGAAGTGGATGG - Exonic
1096746833 12:53734336-53734358 TACTTAGGGGCTGAGGTGGGAGG + Intergenic
1096862011 12:54536125-54536147 TCCTCAGGAGATGAAGTATCTGG - Exonic
1096998237 12:55853924-55853946 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1097043755 12:56172188-56172210 TACTCAGGAGGCTAAGTGGGAGG - Intronic
1097514287 12:60585167-60585189 CACACATGAGCTGAAGTGGCCGG + Intergenic
1097709682 12:62904345-62904367 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1098025672 12:66198862-66198884 TACTCGGTAGCTGAGGTGGGAGG - Intronic
1098199708 12:68041691-68041713 TACCCAGGAGCTAAAGTGAGAGG - Intergenic
1099977592 12:89562438-89562460 TACTCAGGAGCTAAGGCGGGAGG - Intergenic
1100279630 12:93106223-93106245 TCCTCAGGGGCTGAGGTGGGAGG - Intergenic
1101142752 12:101812911-101812933 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1101151228 12:101884277-101884299 TACTCAGGAGCCTGAGTGGGAGG + Intronic
1101463397 12:104921001-104921023 TACTTAGGAACTGAGGTGGGAGG + Intronic
1101662970 12:106783077-106783099 TACTCTGTAGCTGAAGTAGAGGG - Intronic
1102012182 12:109625612-109625634 TCCTCAGGGGCAGCAGTGGCAGG + Intergenic
1102196346 12:111028037-111028059 ACTTCAGGAGCTGAAGTGGGAGG + Intergenic
1102274413 12:111569605-111569627 TACTTGGGAGCTGAGGTGGGAGG + Intronic
1102934402 12:116884357-116884379 TACTCCAGAGCTGAGGTGGGAGG - Intergenic
1103796329 12:123505729-123505751 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1103832513 12:123791016-123791038 TACTCAGGAGCTGAGGTGGGAGG + Intronic
1103881605 12:124170537-124170559 TACTCAGGAGCTGAGATGGGAGG - Intronic
1104437650 12:128768638-128768660 TACTCAGGAGCTGTGGTAGGAGG - Intergenic
1104677312 12:130720350-130720372 TACTCGGGGGCTGAGGTGGGAGG + Intergenic
1105301073 13:19135270-19135292 TACTCAGGGGCTAAGGTGGGAGG - Intergenic
1105608215 13:21944744-21944766 CACACTGGAGCTGAAGTAGCTGG + Intergenic
1106052618 13:26205900-26205922 TACTCAGGAGGTGAGGTGAGAGG + Intronic
1106381672 13:29245415-29245437 TAATCAGGAGCTGGTGTGGAAGG + Intronic
1106813994 13:33387246-33387268 AACTTAGGAGCTGAAGTGGGAGG - Intergenic
1107622779 13:42250263-42250285 TAAATAGGAGCTGGAGTGGCCGG - Intronic
1107645914 13:42494254-42494276 TACTCGTAAGCTGAAGTGGGAGG - Intergenic
1108080462 13:46729441-46729463 AACTCAGGAGCTGAGGTGGGAGG + Intronic
1108131483 13:47306203-47306225 CACTCAGGACCTGAAGTCCCTGG - Intergenic
1108212155 13:48149991-48150013 GAATCAGAAGCTGAAGTGGTGGG - Intergenic
1108216683 13:48192384-48192406 AACTCAGAAGCTGAAATGGGAGG + Intergenic
1108402333 13:50058696-50058718 TACTCAGGAGCTGAAGTGGGAGG + Intergenic
1109777119 13:67055689-67055711 TACTCAGGAGCTGAAGTGGCGGG + Intronic
1110321597 13:74166199-74166221 TACTCGGGGGCTGAGGTGGCAGG - Intergenic
1110375035 13:74783655-74783677 TACTCAGGGACTGAGGTGGGAGG + Intergenic
1110568933 13:76983834-76983856 TACTCAGGAAGTGAGGTGGGAGG + Intergenic
1111125473 13:83907710-83907732 CCCTCTGGAGCGGAAGTGGCTGG - Intergenic
1112458204 13:99580815-99580837 TACTCGGGAACTGAGGTGGGAGG - Intergenic
1112594740 13:100797351-100797373 TACCCAAGAGCTGAGGTGGGAGG + Intergenic
1114074677 14:19152081-19152103 TCTTCAGGAGGTGAAGTGGAAGG - Intergenic
1114087590 14:19247894-19247916 TCTTCAGGAGGTGAAGTGGAAGG + Intergenic
1115644357 14:35357589-35357611 TACTCGGGGGCTGAGGTGGGAGG - Intergenic
1115776991 14:36726322-36726344 TGCTCGGCAGCTGAAGTGGGAGG + Intronic
1116230081 14:42204790-42204812 TACTCAGAAGCTGAGGTGGGAGG - Intergenic
1116453834 14:45094509-45094531 TACTCAGGAGATGCTGTGGCAGG - Intronic
1117173638 14:53126474-53126496 TACTTGGGAGCTGAAGTGGGAGG - Intronic
1117427504 14:55616019-55616041 TACTCTGGGGCTGAGGTGGGAGG - Intronic
1117700671 14:58410178-58410200 TACTCGGGAGCTGAGGTGAGAGG - Intronic
1118195636 14:63623087-63623109 TACTCAGGAGCTTAGGTGGGAGG + Intronic
1118566284 14:67144126-67144148 TACTTGGGTGCTGAAGTGGGAGG + Intronic
1119287978 14:73471499-73471521 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
1119659265 14:76438907-76438929 TACTCAGGAGCTGAGGAGGGAGG - Intronic
1120472781 14:84947479-84947501 TACTTGGGAGCTGAGGTGGGAGG + Intergenic
1120599258 14:86480648-86480670 TACTCAGGAGGTGAGGTGGCAGG + Intergenic
1121536722 14:94695990-94696012 TACTCGGGAGCTGAGGTGGGAGG - Intergenic
1121667022 14:95680382-95680404 TACTCCGGGGCTGAGGTGGGAGG - Intergenic
1123218799 14:106837923-106837945 CACTCACGAGCTCAAGTGTCTGG - Intergenic
1123690558 15:22835231-22835253 TACTCAGGAGTAGAACTGCCAGG + Intergenic
1123810396 15:23919554-23919576 TAAACAGGACCTGACGTGGCAGG - Intergenic
1125136725 15:36352583-36352605 TATTCAGGGGCTGAAGGGCCAGG - Intergenic
1125473425 15:40026346-40026368 TACTCAGGAGCTGAGGTGGGAGG + Intronic
1125569933 15:40708690-40708712 TACTCAGGAGCTAAGGTGAGAGG - Intronic
1125697691 15:41652472-41652494 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1125776229 15:42217061-42217083 TACTTGGGAGGTGAAGTGGGAGG - Intronic
1125898740 15:43325948-43325970 TACTCAGGTACTGAGGTGGGAGG - Exonic
1125951347 15:43754844-43754866 TACTCAGAGGCTGAGGTGGAAGG + Intronic
1126011356 15:44305406-44305428 TACTCGGAGGCTGAAGTGGGAGG - Intronic
1126740251 15:51769920-51769942 TACTTAGGAGCTGATATGGGAGG + Intronic
1126949857 15:53868998-53869020 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1127491733 15:59471569-59471591 TACTTAGAGGCTGAAGTGGGAGG - Intronic
1128081115 15:64857442-64857464 TACTCAGAAGCTGAGGTGGGAGG - Intronic
1128164531 15:65451814-65451836 TACTCGGGGGCTGAGGTGGGAGG + Intronic
1128486193 15:68092279-68092301 TACTCAGGAGGCGAGGTGGGAGG - Intronic
1129333780 15:74840677-74840699 AAGTCAGGAGCTGAAGCAGCTGG - Intronic
1129442853 15:75594479-75594501 TACTTGGGAGCTGAGGTGGGAGG - Intergenic
1129639241 15:77357159-77357181 TACTTGGGAGGTGAAGTGGGAGG + Intronic
1129791672 15:78344805-78344827 TACTCGGAGGCTGAAGTGGGAGG + Intronic
1130565413 15:84990105-84990127 TACTCAGGAGCTGAGGCAGAAGG + Intronic
1130581291 15:85139339-85139361 TGCTTAGGAGCTGAGGTGGGAGG + Intergenic
1131208443 15:90472164-90472186 TACTCAGGAGGTGAGGTGGGAGG + Intronic
1132464303 16:70729-70751 TGCCCAGGAGCTGCAGTGGAAGG + Intronic
1132493378 16:247237-247259 TACCCAGGAGCTGAGGTGGGAGG - Intronic
1133147944 16:3803972-3803994 TACTCGGGGGCTGAAGTGGGAGG + Intronic
1133426749 16:5698576-5698598 TACTCAGGAGTGGAAGTGCTGGG - Intergenic
1133625226 16:7564600-7564622 TTCCCAGGAGCTGAGTTGGCTGG + Intronic
1133802739 16:9097349-9097371 TACTCAGTGGCTGAGGTGGGAGG - Intronic
1133964627 16:10521379-10521401 TACTCGGGAGCTGAGGTGGGAGG + Intergenic
1134140489 16:11714148-11714170 TACTTAGGGGCTGAGGTGGGAGG - Intronic
1134273443 16:12754900-12754922 TATTCAGGAGCTGAGGTGGGAGG + Intronic
1134434201 16:14240413-14240435 GACTCAGGATCTGCAGTTGCAGG - Exonic
1134628930 16:15742922-15742944 TACTCTGGAGCTGGGGTGGGAGG - Intronic
1135039124 16:19104414-19104436 TACTCAGTGGCTGAGGTGGGAGG - Intergenic
1135539975 16:23322407-23322429 TACTCGGGAGCTGAGGTGGAAGG - Intronic
1135995709 16:27246597-27246619 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1136066661 16:27763504-27763526 TACTCAGATGCTGAGGTGGGAGG + Intronic
1136469729 16:30471885-30471907 TACTTAGGAGCAGAGGTGGGAGG + Intergenic
1136581061 16:31150957-31150979 TACTCGGGAGATGAGGTGGGAGG + Intergenic
1137043847 16:35638654-35638676 TCCCCAGGAGCTGAAAAGGCTGG - Intergenic
1137654220 16:50146442-50146464 TACTCAGGAGGTGAGGTGGGAGG - Intergenic
1138001636 16:53287066-53287088 TACTCAGGAGACTAAGTGGGAGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138684987 16:58717266-58717288 TACTCAGGGGCTGAGGTAGGAGG + Intronic
1139360335 16:66394957-66394979 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1139761951 16:69191452-69191474 TACTCAGAGGCTGAGGTGGGAGG + Intronic
1139771125 16:69278205-69278227 TACTCAGAAGCTGAGATGGGAGG + Intronic
1139855331 16:69975263-69975285 TACACTGGAGCTGAGGAGGCCGG + Intergenic
1139910830 16:70396493-70396515 TACTCTGAAGCTGAGGTGGGAGG + Intronic
1140534685 16:75698950-75698972 TACTCAGGGGCTTAGGTGGAAGG - Intronic
1140974851 16:80049945-80049967 TACTCAGGAGCTGAGGCAGGAGG - Intergenic
1141246909 16:82316547-82316569 TACTCAGGGGCTGAGGTAGAAGG - Intergenic
1141264221 16:82481516-82481538 TTCTCTGGAGCAGATGTGGCTGG + Intergenic
1141713063 16:85711202-85711224 TACTCAGGAGCTGAAGCAGGAGG + Intronic
1142423760 16:89989654-89989676 TAGTCAGGTGCTGCAGTGGGTGG + Intergenic
1142777796 17:2154924-2154946 TACTCAGAAGCTGAGGTGGGAGG + Intronic
1142839807 17:2619259-2619281 TACCCAGAGGCTGAAGTGGGAGG - Intronic
1143108775 17:4542246-4542268 CACACAGGAGCTGAGGGGGCAGG - Intronic
1143127275 17:4651180-4651202 TACTCAGGAGCTGAAGCAGGAGG + Intergenic
1143172370 17:4937732-4937754 TCCTCAGTGGCTGAAGCGGCCGG - Exonic
1143192281 17:5048737-5048759 GACTGAGGTGCTGAAGTGGGAGG + Intronic
1143533169 17:7518102-7518124 TACTCAGGAGCCTGAGTGGGAGG - Intergenic
1144604914 17:16656630-16656652 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1144831622 17:18134987-18135009 TACTCAGGAGCTGAGGCAGGAGG - Intronic
1146060754 17:29605574-29605596 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1147013686 17:37473067-37473089 CACTCAGGAGCTGAACTGGGAGG - Intronic
1147367070 17:39966028-39966050 TCATCAGGAGCTGAGGAGGCTGG + Intronic
1147735959 17:42638464-42638486 TACTCAGAGGCTGAGGTGGAAGG - Intergenic
1148891729 17:50812469-50812491 TACTCAGGAGCTGAGATGGGAGG + Intergenic
1149347014 17:55749151-55749173 TATTCAGGAGCTGGTGTTGCTGG + Intergenic
1150150236 17:62803177-62803199 TACTCAGAGGCTGAGGTGGGAGG + Intronic
1150153091 17:62826813-62826835 TACTCGGGAGCTGAGGTGGGAGG - Intergenic
1150706639 17:67493005-67493027 TTCTCAGGAGCTGAATTGTTGGG + Intronic
1152149593 17:78590639-78590661 TACTCAGGAGCTGAGGTGGGAGG - Intergenic
1152392519 17:80011148-80011170 TACTCGGGAGCTGAGGTGGGAGG - Intronic
1152559320 17:81070066-81070088 TACTCAGAAGCTGAGGTGGGAGG - Intronic
1152607080 17:81297072-81297094 TACTGAGGGCCTGAAGTGGGAGG - Intergenic
1152884321 17:82840544-82840566 TCCTCAGGAGCTGAGCCGGCAGG + Exonic
1152903837 17:82960044-82960066 TGCAAAGGAGCTGAAGTGTCAGG + Intronic
1153228457 18:2915087-2915109 TGCTCAAGAGCTGCAGGGGCAGG + Exonic
1153236466 18:2993034-2993056 TACTCAGAGGCTGAGGTGGGAGG + Intronic
1153282015 18:3423569-3423591 TACTCAGGAGCTACTGAGGCAGG + Intronic
1153413214 18:4817042-4817064 TCCTCAGGAGGTGATGTGGATGG + Intergenic
1153497504 18:5714799-5714821 TACTAAGGAGCAGAAGTGCTGGG + Intergenic
1153547873 18:6227778-6227800 TACTCAGAAACTGAGGTGGGAGG - Intronic
1154277006 18:12970527-12970549 TACTCAGGAGCTGAGGCAGGAGG - Intronic
1155496372 18:26446901-26446923 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1155976416 18:32136522-32136544 CCCACAGCAGCTGAAGTGGCAGG + Intronic
1156246265 18:35302209-35302231 TACTCGGGGGCTGAGGTGGGAGG + Intergenic
1157214718 18:45773282-45773304 TACTCAGGAGGTGAGATGGGAGG - Intergenic
1157284798 18:46370424-46370446 TTCTCATGAGCTGAGGTGGATGG + Intronic
1157835976 18:50903557-50903579 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1158852161 18:61505443-61505465 TATTCAGGAGCTGAGGTGGGAGG - Intronic
1158907801 18:62030855-62030877 TACTCAAGTGCTGAGGTGGGAGG + Intergenic
1158927666 18:62285509-62285531 TACTCAGAAGCTGAGGTGGGAGG + Intronic
1160963219 19:1733927-1733949 TACTCAGGAGCTGAGTGGGGAGG + Intergenic
1161243939 19:3238530-3238552 TCCCCAGAAGCTGAAGAGGCAGG - Intronic
1162279835 19:9686919-9686941 TACTCAGGAGCTGAGATAGGAGG - Intergenic
1162737925 19:12756735-12756757 TATTCAGGGGCTGAGGTGGGAGG + Intronic
1162757997 19:12871805-12871827 TACTCGGAGGCTGAAGTGGGAGG + Intronic
1163515851 19:17763203-17763225 TACTCGGGAGCTGAGGTAGGAGG - Intronic
1163534172 19:17867456-17867478 GACTCAGGAGCAGAAGTGCAGGG - Intergenic
1163571669 19:18085716-18085738 TACTTAGGAGCTGAGGTGGGAGG - Intronic
1163840106 19:19602539-19602561 TACTCAGGAGCTGAGGCGGGAGG - Intronic
1163871099 19:19821855-19821877 AACTCAGGACCTGAGGGGGCGGG - Intergenic
1163906454 19:20152730-20152752 TACTCAGGGCCTGAGGGGGCGGG - Intergenic
1164030221 19:21397012-21397034 CACTCAGGGCCTGAAGGGGCGGG + Intergenic
1164123140 19:22286301-22286323 CACTCAGGATCTGAGGAGGCGGG + Intergenic
1164199272 19:23003274-23003296 CACTCAGGGCCTGAAGGGGCGGG - Intergenic
1164199431 19:23004313-23004335 TATTCAGGGGCTGAAGTAGGAGG + Intergenic
1164631549 19:29765125-29765147 TACTTGGGAACTGAAGTGGGAGG + Intergenic
1164788959 19:30959753-30959775 TACTCAGGAGAGGAAGGTGCAGG + Intergenic
1164981969 19:32620775-32620797 TACTCGAGAGCTGAGGTGGGAGG + Intronic
1165031333 19:32999976-32999998 TACTCAGGAGGTGAGGTGGGAGG - Intronic
1165139072 19:33688352-33688374 TACTCTGGGTCTGCAGTGGCTGG + Intronic
1166062311 19:40334338-40334360 TATTCAGGGGCTGAGGTGGTAGG + Intronic
1166327045 19:42057478-42057500 TACTCAGGAGCTGAGGTGGGAGG - Intronic
1166910388 19:46150777-46150799 TACTTGGGAGCTGAGGTGGAAGG - Intronic
1167429340 19:49445601-49445623 TACTCAGAGGCTGATGTGGGAGG + Intergenic
1167599052 19:50443212-50443234 TACTCAGGGGCTGAGGTGGGAGG + Intronic
1167806821 19:51792756-51792778 TACTCAGGAGGTGAAGTGGGAGG - Intronic
1167824123 19:51956550-51956572 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1168640447 19:58028096-58028118 TACTCAGAAGCTGAGGTGGGAGG + Intergenic
925390800 2:3492596-3492618 TACTGAGGTGCTGAGGTGGGAGG - Intergenic
925488013 2:4357818-4357840 TATTCAGGAGCCCAAGTGCCAGG + Intergenic
925689522 2:6506775-6506797 CACTCAGTAGCTGGTGTGGCAGG - Intergenic
926129492 2:10292819-10292841 TACTCAGAAGCTGAGGTGGGAGG + Intergenic
926239163 2:11071498-11071520 CACACAGGAACTGAAGAGGCCGG - Intergenic
926281950 2:11456367-11456389 TCCTCTGTAGCTGAAGTTGCTGG - Intronic
927188287 2:20497982-20498004 GACTCAAGAGCTGCTGTGGCAGG - Intergenic
927530011 2:23788174-23788196 TACCCAGGAGTTGAACTGGCAGG - Intronic
927675319 2:25101456-25101478 TACTCAAAGGCTGAAGTGGGAGG - Intronic
928175019 2:29027647-29027669 TACTGAGGGGCTGAGGTGGGAGG + Intronic
929152259 2:38758032-38758054 TAGTCAGAAGCTGAGGTGGGAGG - Intronic
929181178 2:39041165-39041187 TACTCGGGGGCTGAGGTGGGAGG - Intronic
929353099 2:40984438-40984460 TACTTGGGGGCTGAAGTGGGAGG + Intergenic
929498445 2:42467859-42467881 TACTGGGGAGCTGAGGTGGGAGG + Intronic
930334446 2:50027549-50027571 TACTCAGGAGCTGAGTTGGGAGG - Intronic
930646585 2:53915329-53915351 TATTCGGGAGCTGAAGTGGGAGG + Intronic
930733898 2:54755767-54755789 TACTCAGAGGCTGAGGTGGGAGG - Intronic
930772533 2:55142158-55142180 TACTCTGGAGTTGAGGTGGGAGG + Intergenic
931588728 2:63857470-63857492 TACTCGGGGGCTGAGGTGGGAGG - Intronic
931786217 2:65621551-65621573 TACTTGGGAGCTGAGGTGGGAGG + Intergenic
932573339 2:72949869-72949891 AGCTCAGGAGCTGGGGTGGCTGG + Intronic
932719276 2:74126001-74126023 TACTCAGAGGCTGAGGTGGTTGG - Intergenic
932728670 2:74201464-74201486 TACTCACAAGCTGAGGTGGGAGG - Intronic
933629326 2:84638252-84638274 TACTCAGAGGCTGAGGTGGGAGG - Intronic
933829110 2:86192122-86192144 TACTCAGGAGGTGAGGTGGGAGG + Intronic
934075446 2:88424388-88424410 TACTCGGGGGCTGAGGTGGGAGG + Intergenic
934097247 2:88618071-88618093 TACTCAGAGGCTGAGGTGGGAGG + Intronic
934713737 2:96531468-96531490 GACTCCGGAGCTGAGGTGGGAGG - Intergenic
935061928 2:99615875-99615897 TATCCAGCAGCTGCAGTGGCAGG - Intronic
935062480 2:99620517-99620539 TACTCGGAGGCTGAGGTGGCAGG + Intronic
935263332 2:101373973-101373995 TACTCAGGAGCTGAGGTGGGAGG - Intronic
935479233 2:103563613-103563635 TACTCAGGAGCTGAGGTGAGAGG + Intergenic
935780283 2:106504475-106504497 TACTCGGGAGCTGAAGCAGGAGG + Intergenic
935818043 2:106866018-106866040 TGCTCAGCAGTAGAAGTGGCAGG + Intronic
936155501 2:110044022-110044044 CACTCAGGAGCTGGAGAGGTGGG + Intergenic
936189185 2:110327412-110327434 CACTCAGGAGCTGGAGAGGTGGG - Intergenic
936404560 2:112191084-112191106 TACTCAGAGGCTGAGGTGGAAGG - Intergenic
938489009 2:131748575-131748597 TCTTCAGGAGGTGAAGTGGAAGG - Intronic
939608785 2:144284994-144285016 TACTCAGGAGCTGAGGTGGTAGG + Intronic
939796705 2:146654598-146654620 TACTCTGGAGCTCAGGTGGGAGG + Intergenic
939984519 2:148816408-148816430 TACTTGGAAGCTGAAGTGGGAGG - Intergenic
940248046 2:151641438-151641460 TACTCAGAAGCTGAGGTGGGAGG - Intronic
941460884 2:165770183-165770205 TACTCAGGAGGTCGAGTGTCTGG + Exonic
941947996 2:171121420-171121442 TACTAAGGAGCTGAGGTGGGAGG + Intronic
941963183 2:171274179-171274201 TACTCAGGAGCTGAGGCAGGAGG - Intergenic
942131032 2:172879691-172879713 TACTCAGAGGCTGAGGTGGGAGG + Intronic
942747162 2:179247532-179247554 TACTTAGGAGCTGATGTGGGAGG - Intronic
944196199 2:197055996-197056018 TACTCTGGAGCTGAGGTGAGAGG - Intronic
944452545 2:199857554-199857576 TACTCGGGAGGTGAAGTGGGAGG + Intergenic
944637000 2:201684108-201684130 TACTCGGGGGCTGAGGTGGAAGG + Intronic
947446675 2:230169415-230169437 TTCTCAGGAGCTGAGGTGGGAGG - Intronic
947620541 2:231587917-231587939 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
947676852 2:231989724-231989746 TACTCGGGAGCTGAAGTGGGAGG + Intronic
948083595 2:235227552-235227574 TCCTCAGGAGCTGTGGTGGATGG + Intergenic
948327539 2:237137996-237138018 TACTCTGGACCTAGAGTGGCAGG - Intergenic
948670637 2:239566511-239566533 AAATCAGGAGCTGAAGTGAGAGG + Intergenic
1168801171 20:644152-644174 TACTCAGGAGGCTAAGTGGGAGG + Intergenic
1171000215 20:21407113-21407135 TACTCAGAAGCTGAGGTGGGAGG - Intergenic
1171206541 20:23286093-23286115 TACTCAGGAGCTGAGGTAGGAGG + Intergenic
1171328678 20:24318454-24318476 TACTCTGAGGCTGAAGTGGAAGG + Intergenic
1172041396 20:32048787-32048809 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1172139870 20:32714896-32714918 TACTCAGGAGGTTGAGAGGCAGG + Intronic
1172410314 20:34716639-34716661 TACTCAGGAGACCAAGTGGGAGG + Intronic
1172418738 20:34796116-34796138 TACTCTGGGGCTGAGGTGGGAGG - Intronic
1172998574 20:39089484-39089506 TACTGGGGAGCTGAGGTGGGAGG - Intergenic
1173258622 20:41413433-41413455 GGCTCAGGAGCCGAGGTGGCAGG + Exonic
1174336036 20:49861432-49861454 TACTCTGGGGCTGAGGTGGGAGG + Intronic
1174640262 20:52037507-52037529 TACTCAGAGGTTGAAGTGGGAGG + Intergenic
1175111725 20:56653178-56653200 TACTCGGGAGCTGAGGTGGGAGG - Intergenic
1175127347 20:56762456-56762478 CACACAGGAGCAGAAGGGGCCGG - Intergenic
1175194901 20:57236328-57236350 CGCTCAGGAGGTGAAGTGGTAGG + Intronic
1176725851 21:10431946-10431968 TACTCAGAGGCTGAAGTAGGAGG - Intergenic
1177683645 21:24408893-24408915 TCCTGGGGAGCTGAAGTGGAAGG + Intergenic
1178898626 21:36581592-36581614 TACTTAGAGGCTGAAGTGGGAGG + Intergenic
1179381273 21:40901619-40901641 TACTTGGCAGGTGAAGTGGCTGG - Intergenic
1179677000 21:42989987-42990009 TACTCCGGGGCTGAGGTGGGAGG + Intronic
1180223912 21:46377736-46377758 TACTCAGAGGCTGAGGTGGGAGG + Intronic
1180254925 21:46620312-46620334 TCCTCAGGAGCCAAACTGGCTGG - Intergenic
1180290327 22:10845015-10845037 TCTTCAGGAGGTGAAGTGGAAGG - Intergenic
1180493125 22:15874436-15874458 TCTTCAGGAGGTGAAGTGGAAGG - Intergenic
1180975905 22:19848313-19848335 TGCTCAGGAGCTGCAGAGCCTGG - Exonic
1182461190 22:30485228-30485250 TACTCAGGAGGTGAGGTGGAAGG + Intergenic
1182499690 22:30737430-30737452 TACTCAGGAGCTGAGGTGAGAGG - Intronic
1182613537 22:31569837-31569859 TACTCAGGAGGCTAAGTGGGAGG + Intronic
1182807341 22:33084543-33084565 TACTTGGGAGCTGAGGTGGGAGG + Intergenic
1183165062 22:36141274-36141296 TGCTGAGGAGCTGAGGCGGCAGG - Exonic
1183438589 22:37809709-37809731 TACTCAGGAGGTTAAGTGGGAGG + Intronic
1183499582 22:38170474-38170496 GACTCAGGAGCAGCAGTGTCTGG + Intronic
1183719686 22:39555309-39555331 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1183974791 22:41505306-41505328 TACTCAGAGGCTGAGGTGGGAGG + Intronic
1184078662 22:42201642-42201664 TCCTGAGTAGCTGAAGTTGCAGG - Intronic
1184083810 22:42245855-42245877 TATTCAGGGGCTGAGGTGGGAGG - Intronic
1184119081 22:42438585-42438607 TCCTCAGGCGTTGAAGTGGGGGG + Intergenic
1184379990 22:44139311-44139333 TACTCAGGTGCTGAGGTGGGAGG - Intronic
949486513 3:4544901-4544923 TACTTGGGGGCTGAAGTGGAAGG - Intronic
949909843 3:8893803-8893825 TACTCAGGAGATGTGGTGGGAGG - Intronic
949972977 3:9426989-9427011 TACTTGGGAGCTGAGGTGGGAGG - Intronic
950234864 3:11310054-11310076 TACTGGGGAGCTGAGGTGGGAGG + Intronic
950238417 3:11344758-11344780 TGCTCGGGAGCTGAGGTGGAAGG + Intronic
950327724 3:12128052-12128074 TACTTAGGAGCTGAGGTGGGAGG - Intronic
950912844 3:16613108-16613130 TACTCAGAGGCTGAGGTGGGAGG - Intronic
951547470 3:23842353-23842375 TACTCAGGAGGCGAGGTGGGAGG - Intronic
951808891 3:26677907-26677929 TACTCGGGAACTGAGGTGGGAGG - Intronic
952897970 3:38091353-38091375 TACTTGGGAGCTGAAGTGGGAGG + Intronic
952988809 3:38812922-38812944 TACTCAGGAGCTGAGGTAGGAGG + Intergenic
953279179 3:41536072-41536094 TCTTCAGGAGCTGGAGTGGGTGG - Intronic
953346538 3:42180568-42180590 TACTCAGAAAGTGAAGTGGGAGG + Intronic
953615203 3:44483943-44483965 TACTCAGGGGCTGAGGTGGGAGG - Intergenic
953699843 3:45187132-45187154 TCTTCAGGAGCTGCAGTGCCAGG + Intergenic
954019910 3:47730370-47730392 TACTCAGGAGGTGAGGTGGGAGG + Intronic
954040314 3:47881713-47881735 TATTCAGGAGCTGAGGTAGGAGG - Intronic
954356750 3:50088408-50088430 TACTCAGGAGCTGAGGTGAGAGG - Intronic
954603159 3:51888119-51888141 TACTGGGGGGCTGAAGTGGGAGG - Intergenic
954829712 3:53409684-53409706 TACTCAGGAGCTGAGGTGAGAGG + Intergenic
955713186 3:61801415-61801437 TACTTGGGGGCTGAAGTGGGAGG - Intronic
956627886 3:71284452-71284474 TACTCGGGAGCTGATGTGGAAGG + Intronic
956646715 3:71464165-71464187 TACTTGGGAGTTGAAGTGGGCGG + Intronic
956794506 3:72705491-72705513 TACTCAGGAGCTGAGGTGGGAGG + Intergenic
957355196 3:79074525-79074547 TACTCAGGGGCTGAGGTGGGAGG - Intronic
957373011 3:79320435-79320457 TACTCAGGGGCTGAGGTGGGAGG - Intronic
958456551 3:94338884-94338906 TACTCAGAAGCTGAGGTTGGAGG - Intergenic
959072042 3:101711601-101711623 TACTCAGAAGGTAAGGTGGCAGG - Intergenic
959076538 3:101755001-101755023 TACTCAGGAGTTGGGGTGGGAGG - Intronic
959637842 3:108595325-108595347 TACTCAGAGGCTAAAGTGGGAGG - Intronic
960178998 3:114552103-114552125 TACTCAGGGGGTGAGGTGGGAGG + Intronic
960493896 3:118352528-118352550 TAATTAGGAGCAGAAATGGCTGG + Intergenic
960627579 3:119696179-119696201 TACTCAGTGGCTGAGGTGGGAGG - Intergenic
960803324 3:121560094-121560116 TACTCAGGAGCTGAGGTGGGAGG - Intergenic
962509297 3:136083121-136083143 TACTTAGGGGCTGAGGTGGTAGG - Intronic
962592510 3:136905732-136905754 TACTCAGAAGCTGAGGTTGAGGG - Intronic
963084508 3:141424409-141424431 TACTCAGGATCTGAGATGGGAGG + Intronic
964149198 3:153503667-153503689 AAGTCTGGAGCTCAAGTGGCAGG + Intergenic
964205488 3:154170250-154170272 TACTCAGGAGCTGAGGTGGGAGG + Intronic
964723688 3:159792670-159792692 TAGTAAGGATTTGAAGTGGCTGG + Intronic
964920500 3:161890443-161890465 CCCACAGGCGCTGAAGTGGCTGG - Intergenic
965066604 3:163857938-163857960 ACCACTGGAGCTGAAGTGGCTGG - Intergenic
965589305 3:170347603-170347625 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
966516837 3:180829019-180829041 TCCTCAGGAACTCAAGGGGCCGG + Intronic
967149255 3:186633301-186633323 TACTCAGAGGCTGAGGTGGTAGG - Intergenic
967437821 3:189471155-189471177 TACTCAGGGTCTGAGGTGGGAGG - Intergenic
968266995 3:197370044-197370066 TACTCAGAGGCTGAGGTGGGTGG - Intergenic
968438539 4:609319-609341 TGCTCAGGAGCTGAGGTAGGAGG - Intergenic
968528256 4:1075778-1075800 TACTGAGAAGCTGAGGTGGGAGG - Intronic
968640961 4:1714431-1714453 TACTCGGAAGCTGAAGTGGGAGG + Intergenic
968671762 4:1855915-1855937 TACTGAGGAGCTGCCGCGGCCGG - Exonic
968764080 4:2459074-2459096 AAGCCAGGAGCTGAGGTGGCTGG - Intronic
968821481 4:2855807-2855829 TACTTGGGGGCTGAAGTGGGAGG - Intronic
968859769 4:3158091-3158113 TACTCAGGAGCTGAGGTGGGAGG - Intronic
971318086 4:25583981-25584003 TACTCAGGATCTGAGGCGGGAGG - Intergenic
972549474 4:40115385-40115407 TACTCGGATGCTGAGGTGGCAGG + Intronic
972613902 4:40680122-40680144 TACTTGGGAGCTGAGGTGGGAGG - Intergenic
972649136 4:40999332-40999354 TACTCAGGAAATGAAGTGGGAGG + Intronic
974120716 4:57634936-57634958 TACTCAGGGGCTGATGTGGGAGG - Intergenic
974362754 4:60903494-60903516 TACTCAGGGGCTGAGGCGGGAGG - Intergenic
974936723 4:68417834-68417856 TACTCAGGGGCTGACCTGTCTGG + Intergenic
975553531 4:75637432-75637454 TACTCAGGGGCTGATGTGGGAGG - Intergenic
975602581 4:76118488-76118510 TACTCAGGAGCTGAGGCAGGAGG - Intronic
976297887 4:83489886-83489908 CTCACAGGAGCTGAAGTGGGAGG - Intronic
976623266 4:87150784-87150806 TACCCAGGAGCTGAGCTGGTTGG - Intergenic
977188471 4:93970349-93970371 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
977780978 4:100980714-100980736 TACACAGGGGCTGAGGTGGGAGG - Intergenic
978101727 4:104849582-104849604 TACTTGGGAGCTGAAGTGGGAGG + Intergenic
978248306 4:106602067-106602089 TACTCACGAGCTGGGGTGGAAGG + Intergenic
978766181 4:112407367-112407389 TACTCAGAAACTGAGGTGGGAGG + Intronic
979161145 4:117462890-117462912 TACTCGGGAGCTGAGGTGGGAGG + Intergenic
979526867 4:121726703-121726725 TACCCAGCAGCTGCTGTGGCTGG - Intergenic
979834267 4:125343391-125343413 TGCACAGGAGGTGAAGTGGGAGG - Intronic
980083365 4:128367532-128367554 TAGTCAGGAGGTGAGGTGGGGGG - Intergenic
980181425 4:129406229-129406251 TACACAGGAGATGGAGTGGGAGG + Intergenic
980458265 4:133073142-133073164 CATGCTGGAGCTGAAGTGGCTGG - Intergenic
980561233 4:134479173-134479195 TACTCAGGAGGCCAAGTGGGAGG - Intergenic
981510575 4:145553011-145553033 TACACAGAGGCTGAGGTGGCAGG - Intronic
981945284 4:150335803-150335825 TACTCAGAGGCTGAGGTGGGAGG - Intronic
982160443 4:152563689-152563711 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
982779901 4:159479986-159480008 TACTCAGGAGGTGAGGTGGGAGG - Intergenic
983069092 4:163247975-163247997 TACTCAAGAGCTGAGGTGGGAGG - Intergenic
983557476 4:169071335-169071357 TACTCGGGAGGTGAGGTGGGAGG - Intergenic
983787654 4:171753964-171753986 TACTCAGGGGCTGAGGTGGGAGG + Intergenic
983841937 4:172468000-172468022 TACTCAGAGGCTGAAGTAGGAGG - Intronic
984488091 4:180398209-180398231 TACTCAGGGGCTGAGGTGAGAGG - Intergenic
984515658 4:180735862-180735884 TACTCAGGAGTTGAAATGGGAGG - Intergenic
985291035 4:188388169-188388191 TACTCATGTGCTGCAGTGTCCGG - Intergenic
985489052 5:168368-168390 TACTCGGGGGCTGCAGTGGCCGG - Intronic
986483696 5:8214363-8214385 TACTCAGGGGCTGAGGTGAGAGG - Intergenic
987380839 5:17284483-17284505 TACTCAAGAACTGGAGAGGCCGG + Intergenic
987484873 5:18512623-18512645 TACTCAGGGGGTGAGGTGGGAGG + Intergenic
989594090 5:43140104-43140126 TACTCAGGAGCTGAGGTGGGAGG + Intronic
989628613 5:43458005-43458027 TACTCAGGAGGTGAGGTGGGAGG - Intronic
990328796 5:54705056-54705078 TAGTCAGGAGCTGAGTTGGGAGG - Intergenic
991204813 5:64038542-64038564 TAGCCTGGAGCTGAAGTGACTGG - Intergenic
991336818 5:65557993-65558015 TATTCAGGAGCTGAGGTGAGAGG + Intronic
991688476 5:69204397-69204419 TACTTGGGAGCTGAGGTGGGAGG - Intronic
992061032 5:73047943-73047965 TACTAGGGAGCTGAGGTGGGAGG - Intronic
992170401 5:74095790-74095812 AACTCTGGAGCTGATGTGGAGGG + Intergenic
992689056 5:79225688-79225710 TACTCAGGAGGATAAGTGGAAGG - Intronic
992992173 5:82294844-82294866 GAGTCAGAAGCTGAAGTGCCTGG - Intronic
993694986 5:91050748-91050770 TACTCAGGAGCTGAGGTGGGAGG + Intronic
993726574 5:91374774-91374796 TACTTGGGAGCTGAGGTGGGAGG + Intronic
993929781 5:93923698-93923720 TACTCAGGAGCTGAGGTGGGAGG + Intronic
994343507 5:98659992-98660014 TACTTAGGAGCTGAGGTAGGAGG + Intergenic
994416105 5:99473889-99473911 AAATAAGGAGCTGAAGAGGCTGG - Intergenic
994463862 5:100101283-100101305 AAATAAGGAGCTGAAGAGGCTGG + Intergenic
994921136 5:106045759-106045781 TACTCAGGAGGCTAAGTGGGAGG - Intergenic
994942045 5:106336501-106336523 TACCCAGGAGCTGAAATTACAGG + Intergenic
995122336 5:108549533-108549555 TACTCCAGAGCTGAGGTGGAAGG + Intergenic
996421392 5:123266871-123266893 TAATAAGGAAATGAAGTGGCAGG - Intergenic
996809754 5:127503304-127503326 TACTCAGGGGCTGAGGTGGGAGG + Intergenic
996858096 5:128032269-128032291 TACTCAGGAGCTAAGGTGAAAGG + Intergenic
997100702 5:130965775-130965797 CAAACAGCAGCTGAAGTGGCAGG + Intergenic
997111546 5:131080158-131080180 TACTTGGGAGCTGAAGTGGGAGG - Intergenic
997445628 5:133937781-133937803 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
997533672 5:134599029-134599051 TATTCAGAAGCTGAGGTGGGAGG - Intergenic
998116491 5:139541662-139541684 TACTCAGTAGCTGAGGTGGGAGG + Intronic
998224649 5:140317242-140317264 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
998460538 5:142306805-142306827 TACTCAGGGGCTGAGGTGAGCGG + Intergenic
998559782 5:143160591-143160613 TACTCAGGAGCTAAGGTGGAAGG - Intronic
999165218 5:149543776-149543798 TACTCAGGAGGCTAAGAGGCAGG + Intronic
999757708 5:154677404-154677426 TACTTGGGAGCTGAGGTGGGAGG + Intergenic
999762990 5:154716948-154716970 TACTCAGGAGCTGAGGCAGGAGG + Intronic
1000084493 5:157877446-157877468 TACTGAGAAGTTGAAGTGGGAGG - Intergenic
1000182841 5:158829283-158829305 TACTCAGGAGCTGAGGTGGGAGG - Intronic
1001206740 5:169770402-169770424 TACTCAGAAGCTGAAGCAGGAGG - Intronic
1001742404 5:174064881-174064903 CACTTAGGAGCTGAGGTGGGTGG + Intronic
1002581672 5:180212596-180212618 TACGCAGGGGCTGAAGGTGCTGG - Intergenic
1003153573 6:3572612-3572634 TACTCGGGAGCTGAAGTGGGAGG - Intergenic
1003560501 6:7176024-7176046 TACTCTGGAGCTGAGGTGGGAGG - Intronic
1003949608 6:11105525-11105547 TATTCCGGAGCTGAGGTTGCTGG + Exonic
1004042254 6:11991660-11991682 TACTCAGGAGCTGAAGCAGGAGG + Intergenic
1004101376 6:12615610-12615632 TATTCAGTAGCAGAAGTGGAAGG - Intergenic
1004535231 6:16494025-16494047 CACCAAGGAGCTTAAGTGGCAGG + Intronic
1004555118 6:16689420-16689442 TGCTCGGGAGCTGAGGTGGGAGG - Intronic
1004562796 6:16767007-16767029 TACTCAGGGGCTGAGGTAGGAGG - Intergenic
1004737573 6:18422846-18422868 TACTGAGGAGCTGAGGTGGGAGG + Intronic
1005125943 6:22447040-22447062 TTCTCAGGAACTGCAGAGGCTGG - Intergenic
1005453685 6:25998799-25998821 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
1005472430 6:26174427-26174449 TACTCAGGAGGTGAAGCAGAAGG + Intergenic
1006042695 6:31269309-31269331 TTCTGGGGAGCTGAAGTGGTCGG - Intronic
1006172300 6:32100615-32100637 TACTCAGGGGCTGAGGTGGGAGG + Intronic
1006549807 6:34812571-34812593 TACTCAAGAGCTGGGGTGGGAGG - Intronic
1006607943 6:35272745-35272767 TACTCGGGGGCTGAAGTGGGAGG - Intronic
1006659073 6:35624075-35624097 CACTCAGAAGCTGAGGTGGGAGG - Intronic
1006871078 6:37252746-37252768 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1007035696 6:38671306-38671328 TACTTGGGAGCTGAGGTGGGAGG - Intergenic
1007316873 6:40996184-40996206 TACTCCGGAGCTGAGGTGGAAGG + Intergenic
1007613482 6:43166013-43166035 TACTCGGAAGCTGAGGTGGGAGG - Intergenic
1007638854 6:43319681-43319703 TACTTAGGAGCTGAGGTAGGAGG + Intronic
1007729784 6:43938904-43938926 CACACAGGAGGGGAAGTGGCGGG - Intergenic
1008668813 6:53745218-53745240 TCCTCAGGAGCTGAGGTGAGAGG + Intergenic
1009428415 6:63540077-63540099 TACCCAGGAGCTAAAGTGCAGGG - Intronic
1009576645 6:65471285-65471307 TACTCAATGGCTGAAGTGGGAGG + Intronic
1011312087 6:85990429-85990451 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
1011342086 6:86327436-86327458 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
1011478603 6:87771981-87772003 TACTCAAGAGCTGAGGTGGGAGG + Intergenic
1011827910 6:91332249-91332271 TACTGAGGAGCTGAGGTAGGAGG - Intergenic
1012472257 6:99585577-99585599 TACTCAGAGGCTGAGGTGGTAGG - Intergenic
1013010902 6:106119009-106119031 TACCCAGGAGCTGAGGGGGAGGG - Intergenic
1013039831 6:106422439-106422461 TACTCAGAGGCTGAGGTGGCAGG - Intergenic
1013266016 6:108499640-108499662 TACTCAGGAGCTAAGGTGGGAGG + Intronic
1013304545 6:108836231-108836253 TACTCAGGAGCTGAGGCAGGAGG + Intergenic
1013386954 6:109641275-109641297 TACTCAGGAGCTGAGACGGGAGG - Intronic
1013521286 6:110936070-110936092 TACTTGGGAGCTGAGGTGGGAGG - Intergenic
1013782970 6:113749039-113749061 TACTCAGGAGCTGAGGTGGGAGG - Intergenic
1014439965 6:121462693-121462715 TACTCGGGGGCTAAAGTGGGAGG - Intergenic
1015297956 6:131620393-131620415 TACTCAGGAGCTGAGGTGGGAGG - Intronic
1016928729 6:149380996-149381018 TTCTCAGAAGCTAAAGTGGGAGG + Intronic
1017038968 6:150292510-150292532 TACTCAGGAGCTGACGCAGGAGG - Intergenic
1017130984 6:151108072-151108094 TACTCTGGAGCTGAAGCAGGAGG + Intergenic
1017283093 6:152644427-152644449 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
1017509913 6:155105064-155105086 TACTTGGGAGCTGAGGTGGGAGG - Intronic
1017524515 6:155230940-155230962 TACTCAGGACCTGAGTTGGGAGG - Intronic
1017826500 6:158085883-158085905 TGCCCGGGAGTTGAAGTGGCTGG + Intronic
1017847430 6:158271539-158271561 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1018150455 6:160932311-160932333 TACTCGGGAGCTGAGGTAGGAGG + Intergenic
1018197147 6:161365341-161365363 CACTCAGGGGCTGAAGTTTCTGG + Intronic
1018430830 6:163721111-163721133 AACTCTGGAGCTACAGTGGCTGG - Intergenic
1018433422 6:163741539-163741561 TACTTGGGAGCTGATGTGGGAGG - Intergenic
1019378573 7:709774-709796 TACCCAGGGGCTGAGGTGGGAGG - Intronic
1019790681 7:3011109-3011131 TACTCAGGAGCTGAGGCAGGAGG - Intronic
1019945431 7:4324980-4325002 TACTCAGGAGCTGAGGCAGGAGG + Intergenic
1020024606 7:4890189-4890211 TACTCAGGAGCTGAGGCAGGAGG - Intergenic
1020360670 7:7323611-7323633 TTCACGGGAGCTGAAGTGGGAGG + Intergenic
1021864989 7:24946779-24946801 GATTCATGAGCTGAAGTAGCAGG + Intronic
1022337450 7:29434981-29435003 TACTCAGGAGCTGAGTTAGGAGG + Intronic
1023383566 7:39632706-39632728 TACTAGGGAGCTGAGGTGGGAGG + Intronic
1026297987 7:69072633-69072655 TACTCAGAGGCTGAGGTGGAAGG - Intergenic
1027255839 7:76430319-76430341 AACTCAGGCCCTGAAGTGGGAGG + Intronic
1028069062 7:86427532-86427554 TACTCAGAGGCTAAAGTGGAAGG + Intergenic
1028254745 7:88580308-88580330 TACTCAGGAGTTGAACTGCTAGG + Intergenic
1028543630 7:91973270-91973292 TACTTGGGGGCTGAAGTGGGAGG + Intronic
1028682441 7:93552065-93552087 AACTCAGGAGGTGAAGTGATAGG + Intronic
1028710451 7:93901824-93901846 TACTCAGGAGGTGAGGTGGGAGG + Intronic
1028995702 7:97097675-97097697 TGCTCTGGAGCTGAGGTGGGAGG + Intergenic
1029099405 7:98115992-98116014 TACTCAGGAGCTGACATGGGAGG - Intronic
1029424650 7:100488291-100488313 TAGTGAGGCGCTGAAGAGGCAGG - Exonic
1029899530 7:104023936-104023958 TACTGGGGGGCTGAAGTGGGAGG + Intergenic
1030362532 7:108610197-108610219 TACTCAGGGACTGAGGTGGTGGG - Intergenic
1030874181 7:114792866-114792888 TACTCAGGAGCTGAGATGGGAGG + Intergenic
1030998230 7:116384564-116384586 GACTCTGGAGCTGAACTGCCTGG - Intronic
1031048728 7:116923283-116923305 TACTCAGGAGCTGAGCTGGGAGG + Intergenic
1032317020 7:130847712-130847734 TACTCAGAGGCTGAGGTGGGAGG - Intergenic
1032399765 7:131616561-131616583 TACTTGGGAGCTGAGGTGGGAGG + Intergenic
1032409777 7:131686439-131686461 TACTCGGGGGCTGAGGTGGGAGG + Intergenic
1032744507 7:134772201-134772223 TACTCAGTAGGTGAGGTGGGAGG - Intronic
1033334814 7:140443526-140443548 TACCCAGCAGCTGAAGTTGCAGG - Intergenic
1033385586 7:140871818-140871840 TAGCCAGTAGCTGCAGTGGCTGG - Intronic
1033468410 7:141620156-141620178 TTGTCAGGAGCTGAAGGTGCAGG + Intronic
1034336599 7:150327709-150327731 TACTTGGGAGCTGAGGTGGGAGG + Intronic
1034612015 7:152379604-152379626 TACTCAGAGGCTGAAGTAGGAGG + Intronic
1034614003 7:152398934-152398956 TACTCAGAGGCTGAGGTGGGAGG - Intronic
1034732548 7:153400537-153400559 CACTCAGGAGCTGAAATAGAGGG + Intergenic
1035819854 8:2579699-2579721 TACTGAGCAACTGAAGTGGGGGG - Intergenic
1036403140 8:8428488-8428510 TACTCAGGATGTGAGGTGGGAGG - Intergenic
1036522964 8:9509171-9509193 TACTCAGGGGCTTAGGTGGAAGG + Intergenic
1037054527 8:14422911-14422933 TCCTCAGTCCCTGAAGTGGCTGG - Intronic
1037798300 8:22015579-22015601 TACTTGGGAGCTGAGGTGGGAGG - Intergenic
1037842376 8:22254398-22254420 TACTCTGGAGCTGAGGTGGGAGG + Exonic
1038281029 8:26164825-26164847 TAATCAGGGGCTGAAGTGGAAGG + Intergenic
1038504278 8:28071177-28071199 TCCTCAGAAGCCAAAGTGGCTGG + Intronic
1038802897 8:30765381-30765403 TACTCAGGAGGTGAGGTGCAAGG - Intronic
1039563572 8:38532267-38532289 TACTCAGAAGCTGAGGTGGGAGG + Intergenic
1039740463 8:40378295-40378317 CACTCAGGAGCTGATGTGGTGGG - Intergenic
1040034081 8:42851745-42851767 TACTCCAGAGCTGAAGTGGGAGG - Intronic
1042118853 8:65461928-65461950 TACTCAGTGGCTGAGGTGGGAGG + Intergenic
1042181088 8:66088244-66088266 TCATCTGGAGCTGGAGTGGCTGG + Intronic
1044964638 8:97563109-97563131 TACTCAGGAGCTGATGTAGGAGG + Intergenic
1045130269 8:99144063-99144085 ATCTCAGGATCTGAAATGGCAGG - Intronic
1045279348 8:100736154-100736176 TACTCAGAGGCTGAGGTGGGAGG + Intergenic
1046071432 8:109259605-109259627 TAATGAGGAGCTGAAAAGGCAGG + Intronic
1046330204 8:112704221-112704243 TACTCAGCAGTTGAGGTGGGGGG - Intronic
1046542057 8:115598414-115598436 TACTCAGGCGCTGAGATGGGAGG - Intronic
1046644516 8:116770688-116770710 TACTCAGGAGCTGAGGTGGAAGG - Intronic
1046938191 8:119905750-119905772 TACTCAGGAGGTTGAGAGGCAGG - Intronic
1046945812 8:119973341-119973363 TACTCAGGAGCTGAGGTGGGAGG - Intronic
1047204754 8:122794088-122794110 TACTCAGGTGCTCAGGTGGCAGG - Intronic
1047562251 8:126000155-126000177 CACTGAGGAGCTGAATTTGCTGG + Intergenic
1047618889 8:126586313-126586335 TACTCGGGGGCTGAGGTGGGAGG + Intergenic
1047918378 8:129607162-129607184 TACTCAGGGGCTGAGGTGGGAGG - Intergenic
1048250695 8:132864523-132864545 TGCTCAGGAGGTGCCGTGGCAGG - Intergenic
1048382857 8:133883430-133883452 TGCTCAGGAAATGAATTGGCAGG + Intergenic
1048594818 8:135855160-135855182 TATTAAGGAGCTAAAGTGGATGG + Intergenic
1049060199 8:140270691-140270713 TGCTCCGGAGCTGAGGAGGCAGG + Intronic
1049291706 8:141806808-141806830 TTCTCAGGAGCAGGAGTGGGTGG + Intergenic
1049823820 8:144654393-144654415 TACTCGGGAGCTGAGGTGGGAGG + Intergenic
1049920812 9:362471-362493 TAATGAGGAGCTGAAGTTGCTGG - Intronic
1051305668 9:15706396-15706418 TACTTGGGAGCTGAGGTGGGAGG - Intronic
1051919811 9:22251572-22251594 ATCGCTGGAGCTGAAGTGGCTGG + Intergenic
1052059255 9:23941146-23941168 CACACATGAGCTGAAGCGGCTGG + Intergenic
1052959067 9:34278993-34279015 TACTCAAAGGCTGAAGTGGGAGG + Intronic
1056013367 9:82355906-82355928 TATTCAGGGGCTGAGGTGACAGG - Intergenic
1056316386 9:85394695-85394717 TACTCAAGAGATGAAGGAGCTGG - Intergenic
1057281099 9:93712198-93712220 TACTTGGGACCTGAAGTGGGAGG + Intergenic
1057398494 9:94701574-94701596 TACTCGGGAGCTGAGGTGGGAGG + Intergenic
1057446621 9:95120521-95120543 TACTCGGGGGGTGAAGTGGGAGG - Intronic
1057928999 9:99177434-99177456 TACTCAGGAGCTGAGGTGGGAGG + Intergenic
1058915994 9:109566204-109566226 TCCTCAGGAGTGGAAGTGGTGGG + Intergenic
1058978562 9:110147661-110147683 TACTCAGGAGGCGAGGTGGGAGG + Intronic
1059169019 9:112107144-112107166 TACTTGGGAGCTGAGGTGGGAGG + Intronic
1059190119 9:112317310-112317332 TACTTGGGAGCTGAGGTGGGAGG + Intronic
1059381362 9:113929289-113929311 TTACCAGGAGCTGCAGTGGCTGG - Intronic
1060521489 9:124296548-124296570 CACACAGGAGCAGAAGAGGCAGG + Intronic
1060681176 9:125566453-125566475 TACTTAGGAGGTGAAGTGCGAGG + Intronic
1061047004 9:128171015-128171037 TGCTCAGAAGCTGAGGTGGGAGG + Intronic
1061383300 9:130272655-130272677 TACTCTGGGGGTGAAGTGGGAGG - Intergenic
1061402529 9:130376219-130376241 TACTCCAAAGCAGAAGTGGCAGG - Intronic
1062182029 9:135196038-135196060 ATCTCAGTAGCTGAAGTGGCGGG + Intergenic
1062418805 9:136468956-136468978 TACTCAGAAGCTGAGGTGGGAGG - Intronic
1186003214 X:5038240-5038262 TACTCAGGAGTGGAAGTGTTCGG - Intergenic
1186095636 X:6098687-6098709 CAGTCAGGATCTGAAGTGACAGG - Intronic
1186471713 X:9827103-9827125 TAGTCAGGAGATGGAGGGGCAGG + Intronic
1187521571 X:20019133-20019155 TACTTGGGAGCTGAGGTGGGAGG - Intronic
1187532160 X:20106871-20106893 TACTTGGGAGCTGAGGTGGGAGG + Intronic
1187711321 X:22057480-22057502 TACTCAGGAGCTGAGGTGGGAGG + Intronic
1189102808 X:38208785-38208807 TACTCAGGGGCTGAGGTGGGAGG - Intronic
1189311104 X:40018179-40018201 TTCTCAGGAGCTGAGGTGGGAGG + Intergenic
1189388494 X:40556867-40556889 TACTGGGGGGCTGAAGTGGGAGG - Intergenic
1189872590 X:45399585-45399607 TACTCAGAAGCTGGGGTGGTAGG + Intergenic
1190019570 X:46861730-46861752 TACTCAGGAGCTGAGGTGGGAGG + Intronic
1190082051 X:47364432-47364454 TACTCAGGAGGTGAGGAGGTGGG - Intergenic
1190256853 X:48769868-48769890 TACTCAGAGGCTGAGGTTGCAGG + Intronic
1190405020 X:50078223-50078245 TACTCAGAAGGTGAGGTGGGAGG + Intronic
1190575031 X:51827152-51827174 TACTCAGAGGCTGAGGTGGGAGG + Intronic
1191694949 X:63979595-63979617 CACTCTGGAGCTGGAGTAGCTGG + Intergenic
1193812838 X:86072088-86072110 TACTTGGGAGCTGAGGTGGGAGG - Intergenic
1194047785 X:89030829-89030851 TACTTGGGAGCTGATGTGGGAGG + Intergenic
1194146802 X:90276326-90276348 TATTCTGGAGCTGAAGTTTCTGG + Intergenic
1194152998 X:90349529-90349551 TACTCAGGAGTTGAAGTGGGAGG - Intergenic
1195055633 X:101141839-101141861 TACTCAGGGGCTGAGGTGGGAGG - Intronic
1195327677 X:103771309-103771331 TACTCAGAAGCTGATGTGGGAGG - Intergenic
1195540787 X:106060357-106060379 TACTCTGGAGCTGAAATGAGAGG - Intergenic
1195714120 X:107801762-107801784 TACTCAGGAGCTGAGGTGGGAGG + Intergenic
1195751808 X:108167443-108167465 TACTCGGGGGCTGAGGTGGGAGG - Intronic
1196743544 X:119047219-119047241 TACTCAGCAGCTGAGGTGGGAGG + Intergenic
1196829661 X:119766101-119766123 TACTCAGGAGGTGAGGCGGGAGG + Intergenic
1196835228 X:119807901-119807923 TACTAGGGAGCTGAGGTGGGAGG - Intergenic
1196837049 X:119823350-119823372 TACTAGGGAGCTGAGGTGGTAGG - Intergenic
1196903553 X:120410066-120410088 ACCACTGGAGCTGAAGTGGCTGG + Intergenic
1197103360 X:122683761-122683783 TACTCAGTAGTTACAGTGGCTGG - Intergenic
1197976442 X:132170914-132170936 AAGTCAGGAGCAGAAGTAGCAGG + Intergenic
1198053113 X:132968009-132968031 AATTCAGAAGCTGAAGTGGGAGG + Intergenic
1198533419 X:137566143-137566165 TACTCTGGAGGCGAAGAGGCTGG + Exonic
1198536497 X:137591642-137591664 TACTCAGGGGCTGAGATGGGAGG + Intergenic
1198806417 X:140499622-140499644 TACTGAGGAGGGGAATTGGCAGG + Intergenic
1200499343 Y:3926331-3926353 TACTCAGGAGTTGAAGTGGGAGG - Intergenic
1201502964 Y:14665684-14665706 CAATCAGGATCTGAAGTGACAGG + Intronic