ID: 1109777653

View in Genome Browser
Species Human (GRCh38)
Location 13:67063255-67063277
Sequence GAGGTTTATCCCTGCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2487
Summary {0: 1, 1: 0, 2: 0, 3: 90, 4: 2396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109777653_1109777660 14 Left 1109777653 13:67063255-67063277 CCAGCCCAGCAGGGATAAACCTC 0: 1
1: 0
2: 0
3: 90
4: 2396
Right 1109777660 13:67063292-67063314 TTCATTGTGTACCATTCACAAGG 0: 1
1: 0
2: 0
3: 14
4: 149
1109777653_1109777661 15 Left 1109777653 13:67063255-67063277 CCAGCCCAGCAGGGATAAACCTC 0: 1
1: 0
2: 0
3: 90
4: 2396
Right 1109777661 13:67063293-67063315 TCATTGTGTACCATTCACAAGGG 0: 1
1: 0
2: 0
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109777653 Original CRISPR GAGGTTTATCCCTGCTGGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr