ID: 1109778157

View in Genome Browser
Species Human (GRCh38)
Location 13:67071407-67071429
Sequence CCCTACCAAGGTTTTGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109778157_1109778161 10 Left 1109778157 13:67071407-67071429 CCTTTGCCAAAACCTTGGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1109778161 13:67071440-67071462 ATGCAATAGTGAAAGTAATTTGG 0: 1
1: 0
2: 2
3: 24
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109778157 Original CRISPR CCCTACCAAGGTTTTGGCAA AGG (reversed) Intronic