ID: 1109778315

View in Genome Browser
Species Human (GRCh38)
Location 13:67073246-67073268
Sequence CAGAGCAAAGCTAAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109778315 Original CRISPR CAGAGCAAAGCTAAGGTGAA TGG Intronic
900270171 1:1782966-1782988 CAGGCCAAAGCCAAGGGGAAGGG + Intergenic
901551023 1:9996455-9996477 CAGAGAAAAGCAAAGGAGAAGGG - Intergenic
902981261 1:20125003-20125025 CAGAGGGAAGCAAAGGAGAAGGG + Intergenic
903782742 1:25832429-25832451 CAGAGCAGGGCTGAGGGGAAGGG + Exonic
905273423 1:36801790-36801812 CAGAGGAAAGCAAAGGAGATTGG - Exonic
907526429 1:55056612-55056634 TTGAGCAAGGCTAATGTGAATGG + Intronic
907864075 1:58382034-58382056 CAAAGCAGAGCTAAAGTCAAAGG - Intronic
909525293 1:76615329-76615351 CTCAGCAGAGCTAAGGGGAAGGG + Intronic
910060903 1:83090416-83090438 TAAAGCCAAGCCAAGGTGAAAGG + Intergenic
911092745 1:94030748-94030770 GAATGCAAAGCTTAGGTGAATGG - Intronic
912220273 1:107666113-107666135 AAGAGGAAGGGTAAGGTGAAGGG - Intronic
912497596 1:110101559-110101581 CAGGGCAGAGCGAGGGTGAAAGG - Intergenic
913063340 1:115227496-115227518 CAGAGAACAGCTAAGGCCAAGGG - Intergenic
914394326 1:147250540-147250562 CAGGGGAAAGCTAAGGGGTAGGG + Intronic
914678041 1:149918648-149918670 AAGAGCAAAGGAAAGATGAAGGG - Intergenic
915118747 1:153615724-153615746 CAGGGCAAGGCCAAGGTGAAGGG + Intronic
916156913 1:161860353-161860375 GAGAACAAATTTAAGGTGAAAGG - Intronic
918588073 1:186210545-186210567 CAAAGCAACCCAAAGGTGAAGGG + Intergenic
919845372 1:201639124-201639146 CAGAGCAAAGCAAAGGTGCAGGG + Intronic
920122830 1:203671781-203671803 CACCCCAAAGCTAAGGAGAAAGG + Intronic
920939803 1:210471057-210471079 CAGTGGAAAGCTATGCTGAATGG + Intronic
920991756 1:210946412-210946434 CAGAGTAAAGCAAATGGGAAAGG - Intronic
923031449 1:230252158-230252180 TAGAGCAGTGCTAAGGAGAAAGG - Intronic
924145134 1:241066357-241066379 CAGAGCAAACCTGAGCTGGAAGG - Intronic
924221278 1:241877897-241877919 AGGAACAAAGCTAAGATGAAGGG + Intronic
1064328143 10:14369954-14369976 CAGAGCAATCCAAAGGAGAATGG - Intronic
1065141088 10:22718794-22718816 GAGCACAAAGCTAATGTGAAAGG - Intergenic
1066453358 10:35550885-35550907 CAGAGCAAAGCCAGGGGCAAGGG - Intronic
1067368122 10:45655516-45655538 CAGAGCAGAACTAAATTGAATGG + Intronic
1070057743 10:72952016-72952038 CAAAGCACAGCCAAGGTAAAGGG - Intronic
1070465158 10:76714483-76714505 CAGAGCAGAACTAAGTTAAATGG + Intergenic
1071475129 10:86019283-86019305 CAGAGCACAGCTGGGGTGGAGGG - Intronic
1072522016 10:96237382-96237404 CAGAGCAAATATAGGGTGGAGGG - Intronic
1073772703 10:106752756-106752778 CAGGGTAATGCTAAGGAGAATGG + Intronic
1073834021 10:107419906-107419928 CTTAGCAAAGCTGAGGTAAAGGG - Intergenic
1074352330 10:112749729-112749751 TAGAGCATAGCTAAGTTTAAGGG - Intronic
1075202749 10:120419733-120419755 AAGAGCAAAGCCTATGTGAAGGG + Intergenic
1075262843 10:120977872-120977894 CAAAGTAAAGCCAAGGTGAGAGG - Intergenic
1076254874 10:129014206-129014228 CAGAAGAAAGATAAGATGAAAGG - Intergenic
1077724596 11:4661513-4661535 CAGAGCACAGCCAAGGTGATGGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079096104 11:17511318-17511340 CAGAGCCAAGCTAAGTTGGGTGG + Intronic
1079512064 11:21222519-21222541 CAGAGCAGAACTAAACTGAATGG - Intronic
1080082872 11:28241562-28241584 CAGAGAAAAGCAAAGGGGATTGG + Intronic
1080302064 11:30795673-30795695 CAGAGGAAAGCTGAAGTGATTGG - Intergenic
1080597975 11:33792486-33792508 CAGAGGAAAGAGAACGTGAAAGG + Intergenic
1081332516 11:41821909-41821931 CAGTGCAAAGCTGAGTGGAATGG - Intergenic
1081863874 11:46348966-46348988 CAGAGCAAAGCTAAGGGGCGGGG - Intronic
1083900345 11:65640530-65640552 CAGGCCAAAGCTAAGGTGTGTGG + Intronic
1085558222 11:77445150-77445172 CAGAGATAAGATTAGGTGAAAGG + Intronic
1086183222 11:83980936-83980958 CAGAGCAGGGATCAGGTGAAGGG + Intronic
1086667685 11:89503868-89503890 TAGATCAAAGCTGAGATGAATGG + Intergenic
1086807622 11:91265004-91265026 AAGATGAAAGCCAAGGTGAATGG + Intergenic
1087947652 11:104183719-104183741 CAGAACAAACCTGAAGTGAATGG + Intergenic
1089706532 11:120282046-120282068 AAGGGCAAAGCTAAGAAGAAGGG - Intronic
1091805705 12:3354549-3354571 CAGAGCAGAGCTGATCTGAAAGG - Intergenic
1094371474 12:29742928-29742950 CACAGCAAAGAAAAGGTGAATGG + Intronic
1095158808 12:38891267-38891289 CAGAGCAAAGCTAATTTTAGAGG - Intronic
1096814098 12:54190865-54190887 CTGACCAAAAATAAGGTGAAGGG + Intergenic
1097307412 12:58084899-58084921 CAGAGCAAAGCAGAGCTGCATGG - Intergenic
1099321771 12:81159937-81159959 GACAGCAAAGATAAGGAGAAAGG - Intronic
1100002703 12:89856755-89856777 GAAAGCCAAGCTAAGATGAAAGG + Intergenic
1100454405 12:94738281-94738303 CAGAGCAAAGCACTGGTGATTGG + Intergenic
1100583991 12:95962342-95962364 CAGCCCCAAGCTAAGGAGAATGG - Exonic
1100973615 12:100098245-100098267 CAGAGAAAAGCAAAGTTAAAAGG + Intronic
1101472067 12:105007104-105007126 TAGAGCAAAGGGAAAGTGAAGGG - Intronic
1101919804 12:108923218-108923240 CAGAGTACAGCAAAGGTGACAGG + Intronic
1102007068 12:109595843-109595865 CAGTGCAAAGCAGAGGGGAAAGG - Intronic
1103211666 12:119171536-119171558 CAGAGCAACTCCATGGTGAATGG - Intergenic
1104477729 12:129084357-129084379 CAGAGCAAATCCAAGCTGAGCGG + Intronic
1104586262 12:130050424-130050446 AAAAGCAAAGCTAAGGTGGAAGG - Intergenic
1105331342 13:19419302-19419324 CTGAGCAAATCTAAGCAGAAGGG + Intergenic
1106071942 13:26420847-26420869 CAGATCAAAGCTAAGGTGGCTGG - Intergenic
1106235901 13:27860213-27860235 CAGAGGCAAGCTGAGCTGAAAGG - Intergenic
1106964903 13:35051669-35051691 CAGAGCAAAGGCAATGTGATTGG - Intronic
1107901134 13:45015582-45015604 GAAAGGAAAGCTAAGGTGAGAGG + Exonic
1108246842 13:48524739-48524761 TAGAGCAAAGTTAATGTGACTGG + Exonic
1109778315 13:67073246-67073268 CAGAGCAAAGCTAAGGTGAATGG + Intronic
1110017504 13:70426341-70426363 CAGAGGAATGCTAGGGAGAAGGG + Intergenic
1110822931 13:79937278-79937300 AGGAGCAAAGCTAAGGTAATTGG + Intergenic
1111245920 13:85540870-85540892 CATTGCATAGCAAAGGTGAAGGG + Intergenic
1112215516 13:97427145-97427167 CAGAGCAGAGTTATGGTGTAAGG - Intergenic
1113053499 13:106240693-106240715 CAGAGCAGTGCTGAGTTGAATGG + Intergenic
1114088518 14:19261886-19261908 CAGAGCAAAGGCAATGTGATTGG + Intergenic
1115378709 14:32708813-32708835 CTGAGGAAAGCTAAGGAGGAAGG - Intronic
1119018228 14:71082591-71082613 CAAAGAAAAGCTACGGTAAAGGG - Intronic
1120509971 14:85401321-85401343 CAGAGCAGAGGTAAGGGGAGAGG + Intergenic
1124220284 15:27845295-27845317 TGGAGGAAAGCTAAGGAGAATGG + Intronic
1125211104 15:37216253-37216275 CAGGGCAAAAGTAAGGTGATAGG + Intergenic
1127654528 15:61043953-61043975 CAGAGCAAAGCTGTGCTCAAAGG + Intronic
1128084828 15:64878635-64878657 CAAAGAAAGTCTAAGGTGAAGGG + Intronic
1130022273 15:80241574-80241596 CAGAGCAAAGCAAAGGAGAATGG - Intergenic
1131797550 15:96034922-96034944 CAGAGCAAAGGGAACGTGCAAGG - Intergenic
1133686013 16:8166169-8166191 GAGGCCAAAACTAAGGTGAATGG - Intergenic
1133695254 16:8257065-8257087 CAGAGCAAAGCAACTCTGAAAGG - Intergenic
1133704141 16:8337274-8337296 CAGCTCAAAGCTAAACTGAAAGG - Intergenic
1134853791 16:17503041-17503063 CAGAGCTAAGGAAAGGAGAAAGG + Intergenic
1138302337 16:55942957-55942979 CAAAACTAAGCTAAGGTGATAGG + Intronic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139675645 16:68521403-68521425 AGGAGGAAGGCTAAGGTGAAAGG - Intergenic
1141265913 16:82497089-82497111 TACAGCAAAGATAAGGGGAAAGG - Intergenic
1144325821 17:14178653-14178675 CAGAGAAAAGCAGAGATGAATGG - Intronic
1144474695 17:15575541-15575563 CAGAGAAAAGCAGAGATGAATGG - Intronic
1147237921 17:39071444-39071466 CAGAGCAGAGCAAAGGGGATGGG - Intronic
1147305459 17:39561089-39561111 GAGAACAAGGCTAAAGTGAATGG + Intronic
1148085370 17:44990613-44990635 CAGAGCCAAGATAAGGTGCTGGG - Intergenic
1149775891 17:59356867-59356889 CAGGGCAAAGCTCTTGTGAATGG - Intronic
1150250575 17:63702150-63702172 CAGTGAGAGGCTAAGGTGAAGGG - Intergenic
1154024805 18:10697094-10697116 CAGAGCAAAGCATAGATAAAAGG - Intronic
1155093964 18:22537977-22537999 CACAGAAAATTTAAGGTGAAGGG + Intergenic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156632709 18:38989155-38989177 TAAATCAAAGCTGAGGTGAAAGG - Intergenic
1157272697 18:46288692-46288714 CTGAGCAAAAGTGAGGTGAAGGG + Intergenic
1158095553 18:53766271-53766293 AACAGCAAAGCTTAGGGGAAGGG + Intergenic
1158884791 18:61816481-61816503 AAGGGCAAGGCCAAGGTGAAGGG + Exonic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1159722109 18:71903918-71903940 CAGAGCAAAGCTAAATGGAAAGG - Intergenic
1160031514 18:75265527-75265549 CAAAGAATAGCTAAGGAGAATGG + Intronic
1161219066 19:3109642-3109664 CTGAGCAAAGCTCTGGGGAAGGG + Intronic
1161676723 19:5654899-5654921 CAGAGCAAAAGTAAGGATAAAGG - Intronic
1164769264 19:30795729-30795751 CAGAGAAAAGCTGGGGTCAATGG + Intergenic
1165443602 19:35844596-35844618 CAGAGCTAAGCTCAGGGGTAAGG + Intronic
1165449553 19:35874230-35874252 CTGACCAATGTTAAGGTGAAAGG - Intronic
925512428 2:4642912-4642934 CAATGCAAAGCTAAGGTAAAGGG - Intergenic
925837768 2:7962655-7962677 CAGAGGAAAGCCAAGGTTCAAGG - Intergenic
926267110 2:11333852-11333874 CAGAAAAAAGTTAAGGAGAAGGG + Intronic
926939747 2:18122722-18122744 CATGGCAAGGCTAAGATGAAGGG + Intronic
928784593 2:34867336-34867358 CAGAGCAAAAATAAAATGAAGGG + Intergenic
929226064 2:39512793-39512815 CAGAGGAAGGCTAAGTTGAATGG + Intergenic
930256351 2:49097429-49097451 CAGTGCAAGGCCAAGATGAAAGG + Intronic
932491569 2:72126394-72126416 CAGAGCACAGCTGAGGTGGGAGG - Intergenic
933157289 2:78990472-78990494 CAGGGCAAAGGTTAGGGGAAAGG - Intergenic
937769084 2:125697434-125697456 CAGAGCAAAGCTCTGAGGAATGG - Intergenic
938487685 2:131729479-131729501 CAGAGCAAAGGCAATGTGATTGG - Intronic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
940684349 2:156827517-156827539 CAGATCCAAGATATGGTGAATGG - Intergenic
942193368 2:173493295-173493317 GAGAGGGAAGCCAAGGTGAAGGG + Intergenic
942688095 2:178555470-178555492 GAAAGAAAAGCTAAAGTGAAAGG - Intronic
943554373 2:189383912-189383934 CAGAGGATAGGAAAGGTGAATGG - Intergenic
945100856 2:206261136-206261158 CAGAGCATTGCTAGGTTGAAGGG + Intergenic
945201095 2:207282268-207282290 CAGAGCCAAGCAAAGGTCAATGG + Intergenic
946013895 2:216588556-216588578 AAGAGAAAAGCTCAGGAGAAAGG + Intergenic
948280874 2:236747198-236747220 CAGAGAAATGCTTAGGTGAGGGG - Intergenic
948338215 2:237227985-237228007 AAGAGCAAAGCTAAGGAACAGGG - Intergenic
1169017557 20:2304267-2304289 CAGAGCAATCCTAGGGTTAAGGG + Intronic
1169781342 20:9314024-9314046 CAAAGCACAGCTAAGAGGAAGGG + Intronic
1169843853 20:9968412-9968434 CAGAAGAAAGCCAAGGTGCAAGG + Intergenic
1170292592 20:14787458-14787480 CAGAGCGAAGGTAAGTTGACAGG + Intronic
1171007361 20:21479662-21479684 AAGAGGAAAGATAAAGTGAAAGG - Intergenic
1171528771 20:25837395-25837417 CTAATCAAAGCTAAGGTGAGAGG - Intronic
1171548055 20:26018491-26018513 CTAATCAAAGCTAAGGTGAGAGG + Intergenic
1172325159 20:34028931-34028953 AAGAGCAAGGCTGAGGTGACTGG + Intronic
1179146205 21:38769917-38769939 CAGAGCAAAGCTCACTTAAAGGG - Intergenic
1179540571 21:42081051-42081073 CAGAGCACAGCTAAGATGCTGGG - Intronic
1180048126 21:45319008-45319030 CAGAGCCAGGCCAAGGTCAAAGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180492193 22:15860451-15860473 CAGAGCAAAGGCAATGTGATTGG - Intergenic
1182494295 22:30695232-30695254 CAGAGTCAAGCTCAGGTGTAGGG + Exonic
1184706097 22:46214613-46214635 CAGAGCAAAGATGAGCTGATCGG + Intronic
951512559 3:23520032-23520054 CAGAGCAAAGCTAATGACACAGG - Intronic
952023126 3:29047206-29047228 CAGAGCAAAGTTGATATGAAAGG + Intergenic
952125257 3:30292248-30292270 GAGAGGAAAGGAAAGGTGAAAGG - Intergenic
954315081 3:49796756-49796778 CAGAACCAAGCTAAGGTGGGAGG + Intronic
955401384 3:58594075-58594097 AAGAGCATAGAGAAGGTGAAAGG - Intronic
956412880 3:68996658-68996680 CACAGCACAGCTCAGGTGCAAGG - Intronic
956748528 3:72328670-72328692 CAAAGCAAAGCAAAGGCCAAAGG + Intergenic
957467531 3:80613735-80613757 CAGAGCAAAACCAATGGGAAAGG - Intergenic
960490049 3:118306262-118306284 GAAAGAAAAGCTAAGGTGACAGG + Intergenic
961096069 3:124157963-124157985 CAGAGCACTGTTAAGGAGAAAGG + Intronic
964417546 3:156463383-156463405 CATAGCAAAGTAAAGGTGAGTGG - Intronic
970558755 4:17261735-17261757 CAGAGCCAAGAAAAGGTGAGTGG + Intergenic
970715815 4:18921354-18921376 CAGAGCAAGGCTCATGTAAAAGG - Intergenic
972226751 4:37022079-37022101 GAGAGCAAAGCCATAGTGAAAGG + Intergenic
974381887 4:61151454-61151476 GAGAGGAAAGCGAAGGTAAAGGG - Intergenic
974454038 4:62103025-62103047 CTGAGTAAAGCAAAGGTGATGGG - Intergenic
975748053 4:77493884-77493906 TAGAAACAAGCTAAGGTGAAGGG + Intergenic
981789796 4:148523044-148523066 AAAAGGAAAGCTAAGATGAATGG - Intergenic
985083715 4:186292432-186292454 CAGAACAAAGCGAGGATGAAGGG - Intergenic
985310807 4:188596281-188596303 CAGAGCAAATGTAAGAAGAAAGG + Intergenic
985876962 5:2607215-2607237 CAGAGCAAGGCAGAGGTGAGTGG + Intergenic
986322236 5:6641362-6641384 CTGAGTAAAGCTAAAGGGAATGG + Intronic
986446948 5:7829747-7829769 CAGAGCAAAGGAAAGATGAATGG - Exonic
992168649 5:74080002-74080024 CAGAACAAAGCTAAGGAAAATGG + Intergenic
993029849 5:82693715-82693737 CAGAGGAAATATAAGGGGAATGG - Intergenic
999111732 5:149127239-149127261 CACAGCAAACCTAAGGTCAAGGG + Intergenic
999588316 5:153116086-153116108 GAGAGGAAAGTGAAGGTGAAAGG - Intergenic
1002871341 6:1169774-1169796 CAGAGAAAGGCTCAGGAGAAGGG + Intergenic
1004584270 6:16984370-16984392 CAGAGCAAAGCTGAGATCAGAGG - Intergenic
1004868075 6:19874005-19874027 CAGATCAAGGCTGAGGTGAGAGG - Intergenic
1006683286 6:35812480-35812502 CCCAGCAAAGCTAAGGTGAGGGG + Intronic
1006780284 6:36627799-36627821 CAGAGCAGAGCTAGGGTGGGAGG - Intergenic
1007207251 6:40162917-40162939 CAGAGCATAGCTAATCTGGAGGG - Intergenic
1007795513 6:44343608-44343630 CTGAGCAAAGGAAAGATGAAAGG - Intronic
1008247878 6:49201596-49201618 AAGAGTAAAGGGAAGGTGAAAGG - Intergenic
1009548708 6:65058049-65058071 CAGATCAAATGTTAGGTGAAAGG + Intronic
1010720858 6:79281898-79281920 CAGAGTAAAGTTTTGGTGAAAGG + Intergenic
1011647252 6:89471656-89471678 CTGAGCAAAGTTAAGGAGAAAGG + Intronic
1012889373 6:104881261-104881283 CCAAGCAAGGCTAAGGTTAAAGG + Intergenic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1018090318 6:160340888-160340910 CAGAGAAAAGCCCAGGAGAATGG - Intergenic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1019818253 7:3217413-3217435 GAGGGCAAAGCCAAGGTGAGGGG - Intergenic
1022791418 7:33692995-33693017 CAGCACAAAGCTTAGGGGAATGG + Intergenic
1023184693 7:37521076-37521098 CAGAGGAAGCCTAATGTGAATGG + Intergenic
1023478655 7:40608881-40608903 CAGAGCAAACCTACTGTGATTGG + Intronic
1024471635 7:49773337-49773359 AAGAGAAAAGCCAAGATGAAAGG + Intergenic
1027753968 7:82186475-82186497 CAGAGCAAAGTTAAGGTTGCAGG + Intronic
1028103399 7:86848709-86848731 CAAAGCAAAGGTTATGTGAATGG - Intronic
1028782036 7:94748415-94748437 CAGAGTAAAGGGATGGTGAAAGG + Intergenic
1028827490 7:95290201-95290223 AAGAGAAAAGCTAAGGAGAAAGG + Exonic
1030338166 7:108347873-108347895 CAGGGCAGGGCTAAGGTGGAGGG - Intronic
1031940474 7:127783498-127783520 CAGATAAAAGCTAAAGTGGAAGG - Intronic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1033790845 7:144790899-144790921 CAGAGCCAATCAAGGGTGAAGGG + Intronic
1034681976 7:152935804-152935826 CAGAGCTGATCTAATGTGAAAGG - Intergenic
1036688514 8:10927001-10927023 AAGGGGAAAGCAAAGGTGAAGGG + Intronic
1037415012 8:18640518-18640540 GAGAGCCAAGTGAAGGTGAAGGG - Intronic
1037677221 8:21061605-21061627 CACAGCAAAGCTAGAATGAAGGG - Intergenic
1039744225 8:40409359-40409381 CAGAGCAAAGCAATGAAGAAGGG + Intergenic
1044334036 8:90955379-90955401 CAGACTAAAGGTAAGGGGAATGG + Intronic
1044609271 8:94076479-94076501 CAGAGCAGAGCCCCGGTGAATGG + Intergenic
1045851175 8:106699658-106699680 CAAAGCAAAGATAAGGTCATTGG + Intronic
1045887468 8:107115696-107115718 AAGAACAAAGCGAAGGTTAAAGG + Intergenic
1045961279 8:107971874-107971896 CTGAGCATGACTAAGGTGAAAGG - Intronic
1048788376 8:138076538-138076560 CAGAACTAGGATAAGGTGAAAGG - Intergenic
1048999589 8:139816260-139816282 CAGAGGAAAGCCAAGGGCAAGGG + Intronic
1054694739 9:68348904-68348926 GAGATGAAAGTTAAGGTGAACGG + Intronic
1055242463 9:74200029-74200051 CAGTGCAAAGCTGCAGTGAAAGG - Intergenic
1055954231 9:81759222-81759244 CAGAGGAAAGAAAAGGGGAAAGG - Intergenic
1056984222 9:91346436-91346458 TAGAGCAAAGTTAGGGTGGAGGG - Intronic
1060438634 9:123617714-123617736 CAGAGCAAAGGTCAGGAGACAGG + Intronic
1187318077 X:18216341-18216363 CATGGCAAAGCTTAAGTGAAGGG + Intronic
1187866597 X:23728367-23728389 CAGAGCCCAGGTAAGGTGAGGGG + Intronic
1188555533 X:31408213-31408235 CAGAGCACAGCAAAGCTGCATGG + Intronic
1188613583 X:32130039-32130061 AAGAGCAAAGCTAAAGCGTAAGG - Intronic
1188852226 X:35145884-35145906 CAGAAAAAAGCAAAGCTGAACGG + Intergenic
1189698528 X:43692201-43692223 TAGTGCAAAGCTAGGGTGACAGG + Intronic
1190621494 X:52291663-52291685 CAGAACAAACCTAAGGGGAAAGG + Intergenic
1192068423 X:67911295-67911317 CATAGCTGAGCTAAGGGGAAAGG + Intergenic
1192216038 X:69158782-69158804 CGGAGCACAGCAAAGGTTAATGG + Intergenic
1193678856 X:84492133-84492155 CAGACAATAGCTCAGGTGAAAGG - Intronic
1194978670 X:100417769-100417791 CAGAGCAAAACAAAGGAGCAGGG + Intergenic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1197571465 X:128156047-128156069 CAGAGCAAAGTAAAGGTGAGTGG + Intergenic
1197625640 X:128799178-128799200 CACAGCAAAAATAAAGTGAAAGG - Intergenic
1198480041 X:137032972-137032994 CAGAGAAAAACCAAGGTGAGGGG - Intergenic
1199546056 X:149008272-149008294 CAGCTCAGAGCTAAGGAGAATGG - Intergenic
1199836428 X:151596278-151596300 CAGAGAAAGTCTAAGGGGAAGGG + Intronic
1200707938 Y:6458690-6458712 CAGAGCTAAGCAAAGGAAAATGG + Intergenic
1201026174 Y:9706018-9706040 CAGAGCTAAGCAAAGGAAAATGG - Intergenic
1201578372 Y:15484808-15484830 CAGAGCAAAGCTAATTTTCATGG - Intergenic