ID: 1109780674

View in Genome Browser
Species Human (GRCh38)
Location 13:67106905-67106927
Sequence GGGCCAAGGCTGCAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1049
Summary {0: 1, 1: 0, 2: 12, 3: 127, 4: 909}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109780674_1109780684 13 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780684 13:67106941-67106963 GGTGCCGAGGAGCAAGGCCAAGG 0: 1
1: 0
2: 1
3: 20
4: 243
1109780674_1109780677 -8 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780677 13:67106920-67106942 CTTGGCCCCCTGTGTAATTTGGG 0: 1
1: 0
2: 4
3: 52
4: 204
1109780674_1109780685 16 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780685 13:67106944-67106966 GCCGAGGAGCAAGGCCAAGGTGG 0: 1
1: 0
2: 0
3: 31
4: 199
1109780674_1109780688 18 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780688 13:67106946-67106968 CGAGGAGCAAGGCCAAGGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 246
1109780674_1109780676 -9 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780676 13:67106919-67106941 CCTTGGCCCCCTGTGTAATTTGG 0: 1
1: 0
2: 6
3: 164
4: 2098
1109780674_1109780682 0 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780682 13:67106928-67106950 CCTGTGTAATTTGGGTGCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 94
1109780674_1109780689 24 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780689 13:67106952-67106974 GCAAGGCCAAGGTGGGGCTGAGG 0: 1
1: 3
2: 8
3: 114
4: 704
1109780674_1109780683 7 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780683 13:67106935-67106957 AATTTGGGTGCCGAGGAGCAAGG 0: 1
1: 0
2: 5
3: 54
4: 249
1109780674_1109780687 17 Left 1109780674 13:67106905-67106927 CCAGCACACTGCAGCCTTGGCCC 0: 1
1: 0
2: 12
3: 127
4: 909
Right 1109780687 13:67106945-67106967 CCGAGGAGCAAGGCCAAGGTGGG 0: 1
1: 0
2: 2
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109780674 Original CRISPR GGGCCAAGGCTGCAGTGTGC TGG (reversed) Intronic
900343957 1:2202191-2202213 GGGCCAAGGCCACACGGTGCTGG - Intronic
900628790 1:3623013-3623035 GGGCCGAGGCTGCAGACTGCTGG - Intergenic
900656139 1:3758662-3758684 AGGTCAAGGCTGCAGGGAGCTGG - Intronic
900681169 1:3917447-3917469 AGCTCAAGGCTGCAGTGAGCTGG - Intergenic
900970268 1:5988780-5988802 GGGCCAAGGATGCAGCGTCTGGG - Intronic
900970282 1:5988829-5988851 GGGCCAAGGATGCAGCGTCTGGG - Intronic
900993966 1:6110357-6110379 GGGCCAGGGCTGCACGGGGCAGG - Intronic
901075383 1:6551557-6551579 TCGCCCAGGCTGCAGTGTACTGG - Intronic
901095593 1:6676638-6676660 TCGCCCAGGCTGCAGTGTGTTGG - Intronic
901189026 1:7393333-7393355 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
901238543 1:7680188-7680210 GGGCCAATGCTGCAGTGGCCGGG + Intronic
901325778 1:8364360-8364382 GGCCCAGGGCTGCATGGTGCTGG - Intronic
901403624 1:9031699-9031721 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
901528561 1:9839574-9839596 AGGTCAAGGCTGCAGTGAGGCGG - Intergenic
901541392 1:9919625-9919647 AGGCGGAGGCTGCAGTGAGCCGG - Intergenic
901886197 1:12225012-12225034 AGGCAAAGGTTGCAGTGAGCTGG - Intergenic
902183837 1:14710542-14710564 GGACCCAGGGTGGAGTGTGCAGG - Intronic
902284256 1:15396250-15396272 AGGTCGAGGCTGCAGTGAGCGGG + Intronic
903326186 1:22569853-22569875 GGGGAAGGGCTGCAGTGAGCAGG + Intronic
903547540 1:24136022-24136044 AGGTCAAGACTGCAGTGAGCTGG - Intronic
903629644 1:24757805-24757827 TGGCCCAGGCTGGAGTGCGCTGG + Intronic
903823954 1:26128668-26128690 AAGTCAAGGCTGCAGTGAGCTGG + Intergenic
903871119 1:26435652-26435674 TCGCCCAGGCTGCAGTGTGGTGG + Intronic
904098904 1:28005643-28005665 AAGTCAAGGATGCAGTGTGCAGG + Intronic
904120780 1:28196365-28196387 TTGCCCAGGCTGCAGTGTGGTGG - Intergenic
904499155 1:30904183-30904205 TCGCCAAGGCTGGAGTGTGGTGG - Intronic
905175315 1:36131519-36131541 GGGTTGAGGCTGCAGTGGGCTGG + Intergenic
905223933 1:36467255-36467277 GAGCCCAGGCTGCTGTGAGCTGG + Exonic
905255330 1:36678058-36678080 GAGCCAAGTCTGAAGTGTGCAGG - Intergenic
905433148 1:37939152-37939174 TCGCCCAGGCTGCAGTGTGGTGG - Intronic
905837552 1:41140360-41140382 AGGCGAAGGTTGCAGTGAGCCGG - Intronic
905994043 1:42365588-42365610 AGGCGGAGGCTGCAGTGAGCTGG - Intergenic
906132493 1:43468953-43468975 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
906362468 1:45175517-45175539 AGGTTAAGGCTGCAGTGAGCTGG - Intronic
906580437 1:46931010-46931032 GGGCTGTGGCTTCAGTGTGCTGG - Intronic
906603288 1:47147878-47147900 GGGCTGTGGCTTCAGTGTGCAGG + Intronic
906720421 1:48000320-48000342 GGGCCATAGCTGAAGAGTGCTGG + Intergenic
906913460 1:49982390-49982412 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
907029872 1:51160502-51160524 AGGTGAAGGTTGCAGTGTGCCGG - Intergenic
907152902 1:52305885-52305907 GGGCCAAGGCGGCAGGGCACTGG - Intronic
907369701 1:53992813-53992835 GGGCCAGGGCAGCAGGGGGCTGG + Intergenic
907684309 1:56595115-56595137 AGGTGAAGGCTGCAGTGAGCCGG - Intronic
908246773 1:62233601-62233623 AGGCAGAGGCTGCAGTGAGCCGG - Intergenic
909903106 1:81161770-81161792 AGGTTGAGGCTGCAGTGTGCTGG + Intergenic
910104140 1:83612265-83612287 AGGCCGAGGTTGCAGTGAGCTGG + Intergenic
910570290 1:88693639-88693661 GAGTTAAGGCTGCAGTGAGCTGG + Intronic
911028131 1:93456707-93456729 GAGTCGAGGCTGCAGTGAGCTGG + Intronic
911497739 1:98651187-98651209 GGGCCAAGGCAGCAGGGCCCTGG + Intergenic
911825026 1:102471893-102471915 AGGCAGAGGCTGCAGTGAGCTGG + Intergenic
912132467 1:106619702-106619724 GGGCCAAGGCAGCAAGGGGCTGG - Intergenic
912832580 1:112966785-112966807 TTGCCAAGGCTGGAGTGTGATGG - Intergenic
912842602 1:113052135-113052157 AGGCGAAGGCTGCAGTGAGCCGG + Intergenic
913296734 1:117328889-117328911 AAGTCAAGGCTGCAGTGAGCCGG + Intergenic
914903213 1:151723322-151723344 AGGCAAAGGTTGCAGTGAGCTGG + Intronic
915185164 1:154098972-154098994 GGGCCAAGGCAGCAGGGGCCTGG + Intronic
915473448 1:156138960-156138982 GGGGCAGGGCTGGAGTGTGAGGG + Intronic
915561747 1:156691970-156691992 TGGCCAGTGCTGCAGTGGGCCGG + Intergenic
916519926 1:165554511-165554533 AAGTCAAGGCTGCAGTGAGCTGG - Intronic
916668327 1:166988278-166988300 AGGTCTAGGCTGCAGTGAGCCGG + Intronic
918175889 1:182044997-182045019 AGGTCAAGGCTGCAGTGAGCTGG - Intergenic
918426234 1:184412766-184412788 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
919126161 1:193396013-193396035 GGGCGGAGCCTGCAGTGAGCCGG + Intergenic
919909091 1:202099240-202099262 AGGTCAAGGCTGCAGTGAGCTGG - Intergenic
920053234 1:203175771-203175793 GGGGCCAGGGTGGAGTGTGCAGG + Exonic
920342447 1:205284139-205284161 GTGCCCAGTCTGCAGTGGGCAGG - Intergenic
920348270 1:205320903-205320925 GTGCCAGAGCTCCAGTGTGCTGG + Intronic
920672084 1:208011978-208012000 GGGTCAAGGCTGCAGTGAGACGG - Intergenic
921388093 1:214590857-214590879 AGGTCAAGGCTGCAGTAAGCTGG - Intergenic
921801642 1:219409376-219409398 AGGTCAAGGCTGTAGTGGGCTGG + Intergenic
921862327 1:220052985-220053007 AGGCGGAGGTTGCAGTGTGCTGG - Intergenic
922117214 1:222625804-222625826 AGGCGGAGGCTGCAGTGAGCTGG - Intronic
922294841 1:224240828-224240850 TGGCCCAGGCTGGAGTGTGATGG + Intronic
922342479 1:224668956-224668978 GGGGGCAGCCTGCAGTGTGCTGG - Intronic
922441315 1:225657326-225657348 GGGAGGAGGCTGCAGTGAGCAGG - Intergenic
922554385 1:226521732-226521754 TTGCCCAGGCTGCAGTGTGGTGG - Intergenic
922567248 1:226608792-226608814 GGCCCCAGGCTGCAGGGTTCCGG - Exonic
922742815 1:228024212-228024234 AGGTCAAGGCTGCAATGGGCTGG + Intronic
923013374 1:230106714-230106736 GTGCTAAGGCTGCAGTAAGCAGG + Intronic
923509423 1:234637028-234637050 GGGCAGAGGTTGCAGTGAGCCGG - Intergenic
923539340 1:234876994-234877016 AGGCAGAGGCTGCAGTGAGCTGG - Intergenic
923857894 1:237864502-237864524 GGGCCAAGGCCACTGTGTACTGG + Intergenic
924123941 1:240830284-240830306 GGACAAAGGCTGCAGTGTGCAGG + Intronic
924248440 1:242107340-242107362 GAGTCAAGGCTGCAGTGAGCCGG + Intronic
924361822 1:243249346-243249368 GGGTCAAGGCTGCAATGAGCTGG + Intronic
924608976 1:245558273-245558295 AGCCCAAGGCTGCAGGGGGCTGG + Intronic
924714286 1:246558214-246558236 AGGTCAAGGCTGCAGTCAGCTGG - Intronic
924885542 1:248211561-248211583 GGGCCCAGGCTGGAGTGCGGTGG + Intergenic
924948753 1:248863761-248863783 GGGCCGAGGCAGCAGGGGGCTGG - Intergenic
1062827394 10:582511-582533 AGGTCCAGGCTGCAGTGAGCTGG + Intronic
1062887623 10:1030208-1030230 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1062910216 10:1207274-1207296 AGGCAGAGGCTGCAGTGAGCCGG + Intronic
1062971829 10:1654328-1654350 CACCCAAGGCTGCAGTGTGAGGG + Intronic
1063378830 10:5571592-5571614 TGTCCAAGCCTGGAGTGTGCGGG - Intergenic
1063706339 10:8434650-8434672 GGTCAGAGGCTGCAGTGAGCTGG - Intergenic
1064047781 10:12033461-12033483 AGGTCAAGGCTGCAGTGAGCTGG + Intronic
1064063910 10:12164124-12164146 GGGAACAGGCTGCAGTGTGGAGG - Intronic
1064360252 10:14657878-14657900 CTGCCAAGGCTGCAGTGAGCTGG - Intronic
1065201520 10:23317169-23317191 GGGCCAAGGCAGCAGAGGGCTGG + Exonic
1065207509 10:23371015-23371037 AAGCCAAGGCTGCAGTGAGATGG + Intergenic
1065228245 10:23569554-23569576 AGTTCAAGGCTGCAATGTGCTGG - Intergenic
1065338374 10:24678567-24678589 AGGTTAAGGCTGCAGTGAGCCGG - Intronic
1065590224 10:27256202-27256224 AGGCAAAGGTTGCAGTGAGCTGG + Intergenic
1065830263 10:29608638-29608660 GGGCTGAGGCAGCAGGGTGCTGG - Intronic
1066401520 10:35081184-35081206 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1066987951 10:42484790-42484812 CGGCAGAGGCTGCAGTGAGCTGG + Intergenic
1067113876 10:43420190-43420212 AGGTCGAGGCTGCAGTGAGCCGG - Intergenic
1067175861 10:43944994-43945016 GGGCTAAGGCCTCAGAGTGCTGG - Intergenic
1067211183 10:44261370-44261392 GACCCCAGGCTGCAGTGAGCAGG + Intergenic
1067215737 10:44301198-44301220 GAGCCAAGGCTGCAGCCTGAGGG - Intergenic
1067306860 10:45072356-45072378 AGGCAAAGGCTGCAGTGAGCGGG - Intergenic
1067427233 10:46219607-46219629 GGCCCAAGTCTGCGGTGAGCTGG - Intergenic
1068116272 10:52740580-52740602 GGGCCTAGACTGCAGAGTCCAGG + Intergenic
1068279954 10:54855038-54855060 GGGCTGAGGCTGCAGGGGGCTGG + Intronic
1068468310 10:57425423-57425445 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1069029558 10:63580940-63580962 AGGCTGAGGCTGCAGTGAGCTGG + Intronic
1069109494 10:64427802-64427824 AGGCAAAGGTTGCAGTGAGCTGG + Intergenic
1069835409 10:71304795-71304817 GTGACAGGCCTGCAGTGTGCTGG - Intergenic
1069961966 10:72084409-72084431 GGGGCCGGGGTGCAGTGTGCTGG - Intronic
1070123488 10:73600842-73600864 GGGCGGAGGTTGCAGTGAGCCGG + Intronic
1071450231 10:85786838-85786860 GGGCCCAGGCTGCAAAGGGCAGG + Intronic
1071814610 10:89219970-89219992 GGTCAAAGGCTGCAGGGTGAGGG - Intronic
1071956863 10:90770096-90770118 GGGCCAGGGCTTCAGAGTCCTGG - Intronic
1072137837 10:92563683-92563705 GGGCAGAGGTTGCAGTGAGCCGG + Intronic
1072230100 10:93407386-93407408 TTGCCAAGGCTGGAGTGTGGTGG - Intronic
1072347788 10:94525588-94525610 AGGCCAAGGTTGCAGTGAGCCGG + Intronic
1072539782 10:96389642-96389664 GGACCAAGGCTGGGGTCTGCAGG + Intronic
1072567795 10:96631811-96631833 AGGCGGAGGCTGCAGTGAGCTGG + Intronic
1072783308 10:98264640-98264662 GGACCAAGGCTGCTGTGTGAGGG - Intronic
1072871405 10:99124567-99124589 GGGCCAAGGCAGCAGGGGACTGG + Intronic
1072957925 10:99903400-99903422 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
1073018780 10:100423502-100423524 AGATCAAGGCTGCAGTGAGCTGG - Intergenic
1073121416 10:101124540-101124562 GAGCCAGGGCTGGACTGTGCTGG - Intronic
1073478996 10:103773806-103773828 AAGTCAAGGCTGCAGTGAGCTGG - Intronic
1073676093 10:105648422-105648444 AGGCAGAGGCTGCAGTGAGCCGG + Intergenic
1073799585 10:107026576-107026598 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1074323946 10:112429829-112429851 GGGCCTAGGCGGCAGGGCGCTGG + Intergenic
1074599941 10:114903633-114903655 AGGTCAAGGCTGCAGTGAGCCGG + Intergenic
1075102058 10:119513388-119513410 AGGCCAAGGCTGCACTGAGCCGG + Intronic
1075393282 10:122108801-122108823 AGGCAGAGGCTGCAGTGAGCCGG - Intronic
1075433337 10:122409848-122409870 TGGCGGAGGCTGCAGTGAGCTGG - Intronic
1075446720 10:122518445-122518467 GGTCCAGGGCAGCAGTGAGCAGG - Intergenic
1075558211 10:123448586-123448608 AGGCAAAGGTTGCAGTGAGCCGG - Intergenic
1075673608 10:124281139-124281161 GGGGCAAGGCTGGAGTGGCCAGG - Intergenic
1075891756 10:125957562-125957584 TTGCCCAGGCTGGAGTGTGCTGG + Intronic
1076591834 10:131588827-131588849 GGGTCAAGGCTGCTGCCTGCAGG - Intergenic
1076727708 10:132421247-132421269 GGGCCGGGGCCGCAGGGTGCAGG - Intergenic
1077054332 11:583475-583497 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1077057677 11:603122-603144 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
1077072218 11:680538-680560 AGGCCGAGGCTGCAGCGAGCCGG + Intronic
1077097308 11:804567-804589 GGGCCTGGGCTGCAGAGTGGGGG + Intronic
1077102091 11:827001-827023 GGGACAAGGCTGCGGGGGGCGGG - Intronic
1077212555 11:1378907-1378929 GGGCAGAGGTTGCAGTGAGCTGG - Intergenic
1077228438 11:1448330-1448352 CCCCCAAGGCTGCAGTGTGCTGG + Intronic
1077485313 11:2835822-2835844 GGGCTCAGCCTGCAGTGTCCAGG + Intronic
1077549926 11:3195685-3195707 GGCCCAAGGCAGAAGTGTCCTGG - Intergenic
1078044005 11:7896554-7896576 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1078195126 11:9130826-9130848 GGGCCAAGTCAGAAGTGTTCAGG + Intronic
1078559021 11:12354566-12354588 GGGCGAAGGTTGCAGTGAGCTGG + Intronic
1078874237 11:15377986-15378008 GGGCCAAGGCAGCAGGGGGTTGG - Intergenic
1078979285 11:16514144-16514166 TGGTCAAGGCTGCAGTGAGCCGG + Intronic
1079464361 11:20714589-20714611 AGGTCGAGGCTGCAGTGAGCTGG - Intronic
1079474328 11:20812937-20812959 GGGCGGAGCCTGCAGTGAGCCGG + Intronic
1080397397 11:31902766-31902788 GGGCCAGGGCTGAACTGTGAAGG + Intronic
1081219008 11:40437461-40437483 GGGCAGAGGCTACAGTGAGCCGG - Intronic
1081573101 11:44303552-44303574 GAGCCAAGGCTGGGGTGTGTAGG - Intronic
1081767457 11:45621459-45621481 GGGCCAAGGCAGTAGGGAGCTGG + Intergenic
1081880609 11:46447493-46447515 TTGCCCAGGCTGCAGTGTGGTGG - Intronic
1082815209 11:57503391-57503413 AGGTCAAGGCTACAGTGAGCTGG - Intronic
1082849715 11:57754100-57754122 AGGTCGAGGCTGCAGTGAGCCGG - Intronic
1082904433 11:58291266-58291288 AGGTCGAGGCTGCAGTGAGCTGG - Intergenic
1083209931 11:61176938-61176960 AGGCGGAGGCTGCAGTGAGCCGG - Intergenic
1083255710 11:61494276-61494298 GGGCCAAGGCTGGAATGTAGAGG - Intergenic
1083410356 11:62488469-62488491 GGGCGGAGGCTGCAGTGAACTGG - Intronic
1083483345 11:62964692-62964714 GGGCAGAGGTTGCAGTGAGCCGG - Intronic
1083939211 11:65886275-65886297 GGGCCCAGGAAGTAGTGTGCGGG + Intronic
1084502692 11:69544302-69544324 GGGCAAAGGCTCCAGGGTGATGG + Intergenic
1084862608 11:72030264-72030286 AGGTCGAGGCTGCAGTGAGCTGG + Intronic
1085214411 11:74815484-74815506 AGGCGGAGGTTGCAGTGTGCCGG + Intronic
1085334295 11:75679139-75679161 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
1085477906 11:76799293-76799315 AGGCCAGGGCTGCGGGGTGCAGG - Intergenic
1085573782 11:77584364-77584386 AGGCAAAGGTTGCAGTGAGCTGG - Intronic
1085943378 11:81234727-81234749 GGGTCTAAGCTGCAGTGTGGAGG - Intergenic
1086546489 11:87973622-87973644 AGGACAAAGCTGCAGTGTGGAGG + Intergenic
1087131333 11:94671816-94671838 GGGCCAAGGCAGCAGGGGACTGG - Intergenic
1087211127 11:95447111-95447133 GGACCAAGGCAGCAGAGGGCAGG + Intergenic
1087568676 11:99896015-99896037 GAGCCATGACTGCAGTGTTCAGG - Intronic
1087768427 11:102181075-102181097 AGTCCAAGGCTGCAGTGAGCCGG + Intronic
1088633084 11:111793051-111793073 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
1088685561 11:112281795-112281817 GAGCCAAGGCTGAAATGTCCTGG - Intergenic
1089591824 11:119546698-119546720 GGGCCAAGGTGGCAGAGGGCTGG - Intergenic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1089993707 11:122884864-122884886 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
1090124974 11:124075773-124075795 GGGCCGAGGCAGCAGGGGGCTGG + Intergenic
1090408552 11:126492203-126492225 GGGCTCAGGCTGCAGCGTGAGGG + Intronic
1090635701 11:128689457-128689479 GGGCCCAGGCTGCATTCTGAGGG + Intronic
1090849376 11:130558604-130558626 GGGACAATGCTCCAGTCTGCTGG + Intergenic
1091369741 11:135047989-135048011 TGGCCAAGGCTGGAGTGTAGTGG + Intergenic
1091761882 12:3092970-3092992 AGGCCCAGCCTGCAGTGTCCAGG - Intronic
1091969097 12:4771201-4771223 GGGGCCAGGCTGCTGTGGGCAGG + Intronic
1092623197 12:10296474-10296496 TCGCCCAGGCTGCAGTGTGGTGG - Intergenic
1092791551 12:12075190-12075212 AGGCAAAGGTTGCAGTGAGCGGG - Intronic
1092953387 12:13528126-13528148 AGGCGAAGGTTGCAGTGAGCCGG - Intergenic
1093168802 12:15836241-15836263 GGGCAGAGGTTGCAGTGAGCCGG - Intronic
1093459921 12:19398590-19398612 AGGTCAAGGCTACAGTGAGCAGG + Intergenic
1093502485 12:19828246-19828268 GGGCCAAGGCAGCAAGGTGCTGG + Intergenic
1093525784 12:20102353-20102375 GGGCCAAGGCAGCAGGAGGCTGG + Intergenic
1094146709 12:27236417-27236439 AGGTCCAGGCTGCAGTGAGCTGG - Intergenic
1094193248 12:27718355-27718377 GGGCAGAGGTTGCAGTGAGCCGG + Intronic
1094615184 12:32029933-32029955 TAGCCCAGGCTGCAGTGTGGTGG - Intergenic
1094665234 12:32513523-32513545 GGGCTAAGGTTGCAAGGTGCAGG + Intronic
1094755180 12:33460535-33460557 AGGCAAAGGTTGCAGTGAGCTGG + Intergenic
1095976365 12:47943184-47943206 GGGGCCAGGCTGCAGGGAGCGGG + Intergenic
1096185800 12:49579737-49579759 GGGATAAGGCAGCAGAGTGCAGG - Intronic
1096448929 12:51721025-51721047 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1096505522 12:52090108-52090130 TTGCCAAGGCTGAAGTGTGATGG + Intergenic
1096522531 12:52192219-52192241 GGGCCAAGGCTGGACTGGCCGGG + Intergenic
1096648463 12:53050403-53050425 TGGCCAGGGCTGTAGTGTGAGGG + Intronic
1096650962 12:53061801-53061823 GGGCAATGGCTGCAGGGTGAGGG - Exonic
1096850568 12:54433060-54433082 GGGTCCAGGCTGCAGGCTGCTGG + Intergenic
1097047241 12:56196268-56196290 TTGCCAAGGCTGGAGTGTGGTGG + Intergenic
1097053998 12:56239315-56239337 GGGTCAAGGCTGCAGAAGGCTGG + Exonic
1097054501 12:56241607-56241629 TGGGCAAGGATGCAGTGTGGGGG + Exonic
1097078636 12:56413257-56413279 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
1097081735 12:56436412-56436434 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1097864102 12:64544545-64544567 AGGTTAAGGCTGCAGTGAGCTGG + Intergenic
1097953201 12:65455774-65455796 TTGCCAAGGCTGGAGTGTGGTGG + Intronic
1098025295 12:66194757-66194779 AGGCCAAGGTTGCAGTGAGCCGG + Intronic
1098519681 12:71421157-71421179 GGGCCAAGGTGGCAGGGGGCTGG + Intronic
1098843694 12:75509656-75509678 AGGTCCAGGCTGCAGTGAGCTGG - Intronic
1099516312 12:83600598-83600620 TGGCCCAGGCTGGAGTGTGGTGG + Intergenic
1100017431 12:90027856-90027878 TGGCCCAGGCTGGAGTGTGGTGG + Intergenic
1100022985 12:90092035-90092057 AAGTCAAGGCTGCAGTGAGCTGG + Intergenic
1100511073 12:95274394-95274416 AGGCCGAGGTTGCAGTGAGCCGG + Intronic
1100847835 12:98678826-98678848 GGGCCGAGGCGGCAGGGGGCTGG - Intronic
1101413107 12:104485426-104485448 GGGCCACAGCTGCAGGGAGCGGG + Intronic
1101580948 12:106040389-106040411 GGGCCAAGGCAGCAGGGGGTTGG + Intergenic
1101738692 12:107483095-107483117 AGGTTAAGGCTGCAGTGAGCTGG - Intronic
1101874482 12:108589495-108589517 CGGCCAAGGGTGCAGTGAGGGGG + Intergenic
1102023314 12:109698795-109698817 AGGTCAAGGCTGCAGTAAGCTGG + Intergenic
1102150833 12:110688502-110688524 GGGAGAAGGCTGCAATGAGCAGG - Exonic
1102241602 12:111327991-111328013 AGGTCAAGGCTGCAGTGAACTGG + Intronic
1102496112 12:113320596-113320618 GGGCCAGGCCGGCTGTGTGCGGG + Exonic
1102667405 12:114587002-114587024 TGGCCCAGGCTGGAGTGTGGTGG - Intergenic
1102714114 12:114955204-114955226 AGGTAAAGGCTGCAGTGAGCTGG - Intergenic
1103273884 12:119695723-119695745 AGGTCGAGGCTGCAGTGAGCTGG + Intronic
1103491336 12:121322983-121323005 GGGCCAAGGCTGGAGTGCAGTGG - Intronic
1103626128 12:122221476-122221498 AGTTCAAGGCTGCAGTGAGCTGG - Intronic
1103732288 12:123035926-123035948 AGATCAAGGCTGCAGTGAGCTGG - Intronic
1103872222 12:124100156-124100178 GGGCAGAGCCTGCAGTGAGCCGG - Intronic
1103925883 12:124423178-124423200 GGGCCCAGGCTGAAATGTGAGGG + Intronic
1104092823 12:125529987-125530009 CGGCCCAGGCTGGAGTGTGGTGG - Intronic
1104129097 12:125875509-125875531 AGGCGAAGGTTGCAGTGAGCTGG - Intergenic
1104439551 12:128783714-128783736 TGGCCAAGGCTGCAGTGCAGAGG + Intergenic
1104596822 12:130125870-130125892 GTGCCAAGGCTGCAGGGTGGAGG + Intergenic
1104701836 12:130910652-130910674 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1104712056 12:130994112-130994134 GGGCCAAGGCTGCCCAGTGTGGG + Intronic
1104748266 12:131223206-131223228 GGGCCAAGGTTGGAGGATGCAGG - Intergenic
1104836353 12:131794465-131794487 AGGTCAAGGCTACAGTGAGCAGG + Intronic
1104965561 12:132507461-132507483 GGGCGGAGGCTGGAGTGTCCTGG + Intronic
1105000236 12:132686325-132686347 AGGTCAAGGCTGCTGTGAGCCGG - Intronic
1105739222 13:23304671-23304693 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
1106033051 13:26019698-26019720 GGGCCGTGGCGGCCGTGTGCAGG - Intronic
1106136581 13:26978114-26978136 AGTTCAAGGCTGCAGTGGGCTGG - Intergenic
1106253578 13:28002061-28002083 GGGCCAAGGCAGCAGGGAGCTGG + Intergenic
1106308842 13:28535326-28535348 GGGCCAAGGAAGCAGGGGGCTGG - Intergenic
1107767802 13:43756361-43756383 GGGTCAAGGCCGCAGTGAACCGG + Intronic
1107850705 13:44570258-44570280 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
1108002305 13:45915416-45915438 GGGTCAAGGCGGCAGAGGGCTGG - Intergenic
1108115253 13:47120482-47120504 GGGCGGAGGCTGCAGGGTGTGGG + Intergenic
1108118729 13:47160337-47160359 GGGCCAAGGCAGCAGGGGGCTGG - Intergenic
1108739899 13:53325870-53325892 AGGCAAAAGCTGCAGAGTGCTGG + Intergenic
1108747983 13:53414697-53414719 AGGCCGAGGTTGCAGTGAGCTGG + Intergenic
1108844412 13:54660193-54660215 GGGCTGAGGCGGCAGGGTGCTGG + Intergenic
1109286643 13:60417409-60417431 AGGCAAAGGTTGCAGTGAGCTGG - Intronic
1109780674 13:67106905-67106927 GGGCCAAGGCTGCAGTGTGCTGG - Intronic
1110538936 13:76686066-76686088 GCGCCCAGGCTGGAGTGTGGTGG + Intergenic
1112550413 13:100415335-100415357 GGGTTGAGGCTGCAGTGAGCTGG + Intronic
1112627958 13:101127426-101127448 GGGCGGAGGTTGCAGTGAGCCGG - Intronic
1113468700 13:110530082-110530104 GGGCCCTGTCTGCAGTGAGCAGG - Intronic
1113634809 13:111912291-111912313 TGGCCCAGGCTGGAGTGTGGTGG + Intergenic
1113748828 13:112764725-112764747 GGGCTGGGGCTGCAGTGGGCTGG + Intronic
1113983900 13:114298468-114298490 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
1114412637 14:22515257-22515279 GGGCTCAGACTGCAGTTTGCAGG + Intergenic
1114611241 14:24042260-24042282 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1114647835 14:24265390-24265412 GAGCCAAGGCTTCAGTGTTTGGG - Intergenic
1114850066 14:26373016-26373038 AGGCCTAGGCTTCAGTGTGCTGG - Intergenic
1114886975 14:26864789-26864811 AGGCAGAGGCTGCAGTGTGCGGG + Intergenic
1115297887 14:31850688-31850710 AAGTCAAGGCTGCAGTGAGCTGG - Intronic
1115508077 14:34111699-34111721 GCCTCAAGGCAGCAGTGTGCTGG + Intronic
1115657080 14:35453617-35453639 AGGTGAAGGCTGCAGTGAGCTGG - Intergenic
1116313809 14:43360464-43360486 GGGTCAAGGCAGCAGGGGGCTGG + Intergenic
1116748193 14:48848268-48848290 TTGCCAAGGCTGGAGTGTGGTGG + Intergenic
1118058409 14:62107361-62107383 AGGTCAAGGCTGCAGTGAGCCGG + Exonic
1118171050 14:63388955-63388977 GGGCCATGGCTGCAGTGCTGTGG - Intronic
1118200162 14:63663868-63663890 GGGTCAAGGCGGCAGGGGGCTGG + Intergenic
1118205869 14:63722900-63722922 AGGTCGAGGCTGCAGTGAGCCGG + Intronic
1118664844 14:68056706-68056728 TCGCCAAGGCTGGAGTGTGGTGG - Intronic
1118757601 14:68856112-68856134 TGGCCCAGGCTGGAGTGTGATGG - Intergenic
1119257249 14:73208980-73209002 GGGCCAAGGTGGCAGGGGGCTGG + Intronic
1119393787 14:74310605-74310627 AGGCGGAGGCTGCAGTGAGCCGG - Intronic
1119472648 14:74909393-74909415 GGGCCTAGGCTGGAGTCTGTTGG - Intronic
1119810257 14:77511925-77511947 GGCCCAAGTCTGCAAGGTGCTGG + Exonic
1119925279 14:78487700-78487722 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1120592258 14:86390327-86390349 GGACCAAGGCAGCAGGGAGCTGG - Intergenic
1120669990 14:87352267-87352289 AGGCCGAGGTTGCAGTGAGCTGG - Intergenic
1120792800 14:88600509-88600531 AGGTCAAGGCTGCAATGAGCAGG - Intronic
1120844355 14:89112915-89112937 GGGCTCAGGCTGCAGTGCCCGGG - Intergenic
1121122564 14:91385234-91385256 GGGCCCTGGCTGCGGTGGGCTGG - Intronic
1121419980 14:93806431-93806453 GGGCCAAGCCTGCAGCAGGCAGG + Intergenic
1121835637 14:97089786-97089808 AGGCGGAGGCTGCAGTGAGCTGG - Intergenic
1122271342 14:100569604-100569626 AGGCCAAGCCTGCTGGGTGCTGG - Intronic
1122348770 14:101076108-101076130 GGGCCATGGCTGCTGGGTACTGG + Intergenic
1122521322 14:102345865-102345887 AGGCAGAGGCTGCAGTGAGCCGG - Intronic
1122614852 14:103010245-103010267 TCGCCCAGGCTGGAGTGTGCTGG - Intronic
1122632360 14:103112778-103112800 AGGCCAAGCCTGCAGGGTGCCGG + Intergenic
1123080513 14:105691617-105691639 GGGCCAGGCCTGGGGTGTGCAGG - Intergenic
1202840191 14_GL000009v2_random:114380-114402 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1202909574 14_GL000194v1_random:104577-104599 GGGCCGAGGTGGCAGTGGGCTGG - Intergenic
1123611823 15:22101252-22101274 AGGCAAAGGTTGCAGTGAGCCGG - Intergenic
1124869019 15:33522191-33522213 GGGCAGAGGCTGCAGTGAGCTGG + Intronic
1125241504 15:37582229-37582251 GGGCCGAGGTGGCAGTGGGCTGG - Intergenic
1125598263 15:40901090-40901112 GGGCCATGGCTAGAGGGTGCTGG + Intronic
1125663086 15:41409449-41409471 AGGCGAAGGTTGCAGTGAGCTGG + Intronic
1125718038 15:41830812-41830834 GGGCCAAGGAGGCAGGGGGCTGG - Intronic
1125829419 15:42703431-42703453 AGGCGGAGGCTGCAGTGGGCAGG - Intronic
1125851263 15:42905341-42905363 AGGTCAAGGCTGCAATGAGCTGG - Intronic
1125909451 15:43422922-43422944 AAGTCAAGGCTGCAGTGAGCCGG + Intronic
1126000650 15:44206391-44206413 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1126029904 15:44486831-44486853 AGGCAGAGGCTGCAGTGAGCGGG - Intronic
1126990911 15:54374433-54374455 GGGCCAAGGCAGCAGGGAGCTGG + Intronic
1127446574 15:59069032-59069054 TCGCCAAGGCTGGAGTGTGGTGG - Intronic
1127525994 15:59792317-59792339 GGGTCAAGGCAGCAGGGGGCTGG + Intergenic
1127788694 15:62378960-62378982 GGGCCTTGGCTGCACTGTGATGG + Intergenic
1127817973 15:62629151-62629173 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1127931745 15:63601436-63601458 GGGCCAGGGCTGCCGCGCGCAGG + Exonic
1128737739 15:70062812-70062834 GGGCAGAGGCAGCAGTGGGCAGG - Intronic
1128839737 15:70840468-70840490 GGGCGGAGGTTGCAGTGAGCCGG + Intronic
1128965212 15:72051706-72051728 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
1129011238 15:72419449-72419471 AGGCGAAGGTTGCAGTGAGCCGG + Intergenic
1129070470 15:72946357-72946379 GGGCAAAGGCTTCGGTGGGCAGG - Intergenic
1129350165 15:74951414-74951436 GGGCCCAGGCTGGAGTGCGATGG + Intergenic
1129411804 15:75354520-75354542 CAGCCAGGGCTGCAGAGTGCAGG - Intronic
1129518320 15:76170495-76170517 GGCCCAGGGCTTCATTGTGCAGG + Intronic
1129545400 15:76389994-76390016 TTGCCCAGGCTGCAGTGTGGTGG + Intronic
1129808696 15:78487514-78487536 AGGTTAAGGCTGCAGTGAGCTGG + Intronic
1130138348 15:81200437-81200459 GAGTCAAGGCTGCAGTGAGCCGG - Intronic
1130299987 15:82673252-82673274 TGGCCCAGGCTGGAGTGTGGTGG + Intronic
1130962926 15:88676312-88676334 TCGCCCAGGCTGCAGTGTGGTGG + Intergenic
1131114274 15:89784489-89784511 GAGGCAAGGGTGCAGGGTGCTGG - Intergenic
1131479918 15:92772004-92772026 AGGCCAAGGCTGCAGTGACTTGG - Intronic
1132146841 15:99434156-99434178 GGGTCACGGCTGCCGAGTGCAGG - Intergenic
1132410824 15:101577179-101577201 GGGCCAGGGATGCAGAGAGCCGG - Intergenic
1132459045 16:40981-41003 AGGTCCAGGCTGCAGTGAGCTGG + Intergenic
1132590169 16:723136-723158 GGGCCCAGGATGCAGCGTCCAGG + Exonic
1132592683 16:733179-733201 GGGCCCTGGCTGGAGTGTGGGGG - Intronic
1132926510 16:2432475-2432497 GGGCCAACGCAGGAGTGTCCAGG - Intronic
1133032684 16:3018930-3018952 TCGCCAAGGCTGGAGTGTGGTGG + Intronic
1133232396 16:4372811-4372833 GGCCCAGGGGTGGAGTGTGCAGG + Intronic
1133364068 16:5197139-5197161 GGGACAAGCCTGCACTGTGAAGG - Intergenic
1133566168 16:6995719-6995741 TGGCCCAGGCTGCAGTGCGGTGG - Intronic
1133946229 16:10351116-10351138 TGGCCCAGGCTGGAGTGTGGTGG + Intronic
1134386850 16:13781328-13781350 TGGACAAGACAGCAGTGTGCGGG + Intergenic
1134869514 16:17639033-17639055 AGGCGGAGGCTGCAGTGAGCCGG - Intergenic
1135208195 16:20499989-20500011 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1135210704 16:20523711-20523733 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
1135246815 16:20863671-20863693 AGGTCAAGGCTGCAGTGAGCTGG + Intronic
1135650603 16:24203153-24203175 AGGTCAAGGCTGCAGTGTCGTGG + Intronic
1135734981 16:24923646-24923668 AGGTCAAGGCTGCAGTGGACTGG + Intronic
1136011921 16:27369053-27369075 TGTTCAAGGCTGCAGTGAGCCGG - Intergenic
1136042306 16:27589830-27589852 TGGCCCAGGCTGCAGTGTAGTGG + Intronic
1136355464 16:29742345-29742367 TTGCCCAGGCTGCAGTGTGATGG - Intergenic
1136427460 16:30178625-30178647 GGAACCAGGCTGGAGTGTGCTGG - Intergenic
1136450574 16:30352290-30352312 GGGCCAAGTGTGCATTGTACTGG - Exonic
1136594122 16:31235654-31235676 AGGCCGAGGTTGCAGTGAGCTGG - Intergenic
1137251155 16:46741838-46741860 AGGTCGAGGCTGCAGTGAGCTGG - Intronic
1137334390 16:47533549-47533571 GGGCCGAGGCTGCAGGGGGCTGG + Intronic
1137559395 16:49493101-49493123 GTGCCACGGCTGGAGGGTGCGGG - Intronic
1137692845 16:50441433-50441455 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1137840011 16:51632115-51632137 TAGCCAAGGCTGCATTGTGTGGG + Intergenic
1138346975 16:56326105-56326127 GGGCCAGGACAGGAGTGTGCTGG - Intronic
1138378116 16:56581021-56581043 AGGTCGAGGCTGCAGTGAGCGGG - Intergenic
1138483092 16:57317144-57317166 TGGCCAAGGCTGCTGTGTGCTGG + Intergenic
1138485438 16:57339932-57339954 AGGCCAAGGCTGCAATGAGCCGG - Intergenic
1138557188 16:57778238-57778260 TTGCCCAGGCTGCAGTGTGGTGG - Intronic
1138704385 16:58899242-58899264 AGCCCGAGGCTGCAGTGAGCTGG + Intergenic
1138998179 16:62477960-62477982 GGGCCAAGGAGGCAGGGGGCTGG - Intergenic
1139528360 16:67529747-67529769 GTGCCCTGGCTGCAGTCTGCGGG + Exonic
1139552761 16:67684624-67684646 AGGCGAAGGTTGCAGTGAGCCGG + Intronic
1139701769 16:68712105-68712127 GGGTTGAGGCTGCAGTGAGCTGG - Intronic
1139897216 16:70297250-70297272 TCGCCCAGGCTGCAGTGTGATGG + Intronic
1139921728 16:70464806-70464828 AGACCAAGGCTGCAGTGAGCTGG + Intronic
1140111742 16:72010796-72010818 AGGTCCAGGCTGCAGTGAGCCGG - Intronic
1140484324 16:75281903-75281925 AGGTCAAGGCTGGAGTGAGCTGG - Intergenic
1140672756 16:77294933-77294955 GGTCCAAGGCTCCATTGTGGAGG + Exonic
1141098057 16:81176948-81176970 TTGCCAAGGCTGGAGTGTGGTGG - Intergenic
1141966826 16:87451264-87451286 AGGCGAAGGTTGCAGTGAGCTGG - Intronic
1142315435 16:89341813-89341835 GGGCCGTGGCTGCTGTGGGCTGG - Intronic
1142436924 16:90065693-90065715 GCGCCAAGGCTGCAGTGCAATGG - Intronic
1142848022 17:2691489-2691511 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
1142853690 17:2717986-2718008 AGGCAGAGGCTGCAGTGAGCCGG - Intergenic
1143003772 17:3813401-3813423 TGCCCAAGGCTGCACTGTGGTGG - Intronic
1143152002 17:4813077-4813099 GGGCAGAGACTGCAGTGAGCTGG - Intronic
1143507061 17:7372771-7372793 TGGCCCAGGCTGGAGTGTGATGG + Intergenic
1143660012 17:8318931-8318953 GAGCCCAGGCTGGAGTGGGCAGG + Intronic
1143908427 17:10227819-10227841 TGGCCTAGGCTGGAGTGTGATGG - Intergenic
1144519230 17:15943394-15943416 GGTTCGAGGCTGCAGTGAGCTGG - Intergenic
1144695410 17:17301083-17301105 GGGCCAAGGAGGCAGGGGGCTGG - Intergenic
1145181705 17:20758925-20758947 GGGCGAAGGTTGCAGTGAGCTGG - Intergenic
1145848625 17:28068099-28068121 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1146171903 17:30640958-30640980 AGGCGAAGGTTGCAGTGAGCTGG - Intergenic
1146303748 17:31713354-31713376 TTGCCCAGGCTGCAGTGTGGTGG - Intergenic
1146345359 17:32056983-32057005 AGGCGAAGGTTGCAGTGAGCTGG - Intergenic
1146425249 17:32732068-32732090 GGGCCAAGGTAGCAGGGGGCTGG - Intronic
1146499806 17:33354609-33354631 GGGCCCAGGCTGGAGTGGGAAGG - Intronic
1147247969 17:39134584-39134606 TGGCCTAGGCTGGAGTGTGATGG - Intronic
1147736215 17:42640107-42640129 TTGCCCAGGCTGCAGTGTGGTGG + Intergenic
1148132600 17:45270986-45271008 GGGCCCAGGCTGCAGGCTGGAGG - Intronic
1148152594 17:45405310-45405332 GGGGCAGGGCTGGAGTGGGCGGG - Intronic
1148794480 17:50190474-50190496 GGGCCAGGGGTGCTGTGTGAAGG + Intronic
1148927207 17:51097865-51097887 AGGTCAAGGTTGCAGTGAGCTGG - Intronic
1149246300 17:54712391-54712413 TTGCCCAGGCTGCAGTGTGGTGG + Intergenic
1149342024 17:55697419-55697441 AGGCAGAGGTTGCAGTGTGCAGG - Intergenic
1149708962 17:58721210-58721232 AGGCGCAGGCTGCAGTGAGCTGG + Intronic
1149976666 17:61272567-61272589 AGGTCAAGGTTGCAGTGAGCCGG + Intronic
1150233424 17:63572800-63572822 TTGCCCAGGCTGCAGTGTGGTGG + Intronic
1150345948 17:64404852-64404874 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1150356759 17:64493345-64493367 AGGCCAAGGTTGCAGTGAGCTGG + Intronic
1150373012 17:64657632-64657654 AGGTCAAGGCTGCAGTAAGCCGG + Intronic
1150790888 17:68199470-68199492 GCTTCAAGGCTGCAGTGTGGCGG + Intergenic
1150961558 17:69918522-69918544 TTGCCAAGGCTGGAGTGTGGTGG + Intergenic
1151602016 17:75111666-75111688 AGGTCAAGGCTGCAGTGAGCTGG + Intronic
1151672941 17:75582250-75582272 TCGCCCAGGCTGCAGTGTACTGG + Intergenic
1151740820 17:75980465-75980487 TCGCCCAGGCTGCAGTGTGGTGG + Intronic
1151773039 17:76177464-76177486 GGGCCGAGGCAGCAGGGGGCTGG - Intronic
1151881498 17:76897984-76898006 AGGCAGAGGCTGCAGTGAGCCGG + Intronic
1152045596 17:77933002-77933024 GGGCGGAGGTTGCAGTGAGCTGG + Intergenic
1152068135 17:78122550-78122572 GGGCCAGGCCTGCAGGGAGCTGG + Intronic
1152078856 17:78174357-78174379 GGGCCAAGGCTCAAAGGTGCTGG + Exonic
1152145470 17:78565878-78565900 AGGCGGAGGTTGCAGTGTGCTGG + Intronic
1152212596 17:79010268-79010290 GGTCTAAGGCTGTAGTGTCCTGG + Intergenic
1152222573 17:79076940-79076962 AGGCGAAGGTTGCAGTGAGCCGG - Intronic
1152437906 17:80287431-80287453 AGGTCAAGGCTACAGTGAGCTGG + Intronic
1152646439 17:81470966-81470988 GTGCCAGGGCTTCTGTGTGCTGG - Intergenic
1152716247 17:81902172-81902194 GGGCCGAGGCTGCGGAGGGCCGG - Exonic
1152796313 17:82309296-82309318 GGGCCAAGCCTGGAGTGGGAGGG + Intergenic
1152808188 17:82368068-82368090 GGGCAGGGGCTGCAGGGTGCAGG + Intergenic
1152894883 17:82905339-82905361 GGACGGAGGCTGCGGTGTGCTGG - Intronic
1153428037 18:4987801-4987823 GGGCCAAGGCAGCAGAGGGCTGG + Intergenic
1153693392 18:7616194-7616216 TTGCCAAGGCTGGAGTGTGGTGG + Intronic
1153866709 18:9276642-9276664 AGGCCAAGGCTGCAGTGAGCTGG + Intronic
1155053950 18:22169505-22169527 GAGCCCAGGCTGCAGTTTTCCGG + Exonic
1155974954 18:32118757-32118779 AGGCCAAGGTTGCAGTGAGTCGG + Intronic
1157255181 18:46132336-46132358 AGGACAAGGTTGCAGTGAGCCGG + Intergenic
1157680075 18:49598232-49598254 TGGCCCAGGCTGGAGTGTGGTGG + Exonic
1158022616 18:52860934-52860956 GGGCGGAGGTTGCAGTGAGCTGG + Intronic
1158153048 18:54394075-54394097 GTGCCCAGGCTGGAGTGTGATGG + Intergenic
1158681686 18:59573213-59573235 AGGCAGAGGCTGCAGTGAGCCGG + Intronic
1158867524 18:61652298-61652320 TGGCCCAGGCTGGAGTGTGGTGG + Intergenic
1159766961 18:72502718-72502740 GGGTCAAGGCTGCATGGGGCTGG + Intergenic
1160022164 18:75189474-75189496 AGGTCGAGGCTGCAGTGAGCTGG + Intergenic
1160083634 18:75754021-75754043 GGGCCAAGGCAGCAGGGGACTGG + Intergenic
1160116687 18:76085225-76085247 GTGCCAAGGCAGCAGGGGGCTGG + Intergenic
1160627215 18:80218989-80219011 GTGCCAAGGCTGCAGACAGCAGG + Intronic
1160658375 19:286117-286139 GGGCCCAGGCTGGAGTGCGGTGG - Intronic
1160702016 19:512231-512253 CGGTCGAGGCTGCAGTGAGCTGG - Intronic
1160756960 19:762726-762748 AGGTCAAGGTTGCAGTGAGCTGG - Intronic
1160784833 19:895187-895209 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1160877510 19:1303987-1304009 AGGCGGAGGCTGCAGTGAGCCGG - Intergenic
1161000429 19:1907974-1907996 GGGCCCAGCCTGCAGTGTCCCGG + Intronic
1161064491 19:2231010-2231032 CCGCCAAGGCTGCAGAGTGGGGG - Exonic
1161286121 19:3469285-3469307 GGGCAGAGGCTGCAGGGAGCTGG + Intergenic
1161849294 19:6730588-6730610 GGGCCAGGGCTGCTGGGGGCGGG - Intronic
1161944454 19:7426445-7426467 TCGCCCAGGCTGGAGTGTGCTGG - Intronic
1161953231 19:7478994-7479016 CGGCCGAGGCTGGAGAGTGCAGG - Intronic
1162621747 19:11849121-11849143 GGGCCAAGGCCGCAGTCGACGGG - Intronic
1162716234 19:12636265-12636287 GGGCGGAGGTTGCAGTGAGCCGG - Intronic
1162923471 19:13918066-13918088 GGGCCAGGGCTGCAGGGACCTGG - Exonic
1162942372 19:14018939-14018961 AGGTCAAGGCTACAGTGAGCTGG + Intergenic
1162990529 19:14299069-14299091 AGGCGAAGGTTGCAGTGAGCTGG + Intergenic
1163126782 19:15248495-15248517 GGAACCAGGCTGCAGTATGCAGG - Intronic
1163331702 19:16642784-16642806 TTGCCAAGGCTGGAGTGTGGTGG - Intronic
1163354408 19:16800459-16800481 AGGCGAAGACTGCAGTGAGCCGG + Intronic
1163360013 19:16839932-16839954 AGGCAAAGGTTGCAGTGAGCCGG + Intronic
1163449272 19:17366072-17366094 GTGCTAAGGCTGCAGGGAGCCGG - Intronic
1163465420 19:17465429-17465451 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1163670356 19:18624145-18624167 AGGCAAAGGTTGCAGTGAGCTGG + Intergenic
1163704705 19:18805428-18805450 GGGTCGAGGCTGCAGTGAGCCGG - Intergenic
1163861858 19:19747038-19747060 GGGCCAAGGCTGCATGCTGGAGG + Intergenic
1164058324 19:21642152-21642174 GGGCAGAGCCTGCAGTGAGCCGG + Intergenic
1164223627 19:23221618-23221640 GTGCCCAGGCTGGAGTGTGGTGG + Exonic
1164644064 19:29845094-29845116 GGGCCAGGGCGGCGGTGGGCGGG + Intergenic
1165044541 19:33094378-33094400 AGGTCAAGGCTGCAGTATGCCGG - Intronic
1165113175 19:33513796-33513818 CGGCAAAGGCTGGAGTGTTCTGG - Intronic
1165302717 19:34981235-34981257 AGACCAAGGCTGCAGTGAGCTGG + Intergenic
1165637208 19:37350872-37350894 AGGCCGAGGTTGCAGTGAGCTGG - Intronic
1165783800 19:38448871-38448893 AGGTCAAGGCTGCAGTGAGCTGG + Intronic
1165863954 19:38924681-38924703 TCGCCCAGGCTGCAGTGTGATGG + Intronic
1165916223 19:39262477-39262499 GGGCCCAGCCTGGAGTGTGGTGG - Intergenic
1166697864 19:44864246-44864268 AGGTCAAGGCTGCAGTGAGCTGG + Intronic
1166748216 19:45152009-45152031 GGGCCAAGTCCCCAGTGTGGTGG + Exonic
1166752224 19:45169778-45169800 GGGCCCAGGCTGCACTCTGAGGG + Intronic
1167272525 19:48513879-48513901 CGGCCTAGGCTGCAGGGTGGAGG + Intergenic
1167843826 19:52143736-52143758 TTGCCCAGGCTGCAGTGTGGTGG + Intergenic
1168023453 19:53626482-53626504 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1168093958 19:54103746-54103768 AGGCCGAGGTTGCAGTGAGCCGG - Intronic
1168096819 19:54120678-54120700 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
1168116893 19:54227203-54227225 AGGTCGAGGCTGCAGTGAGCTGG - Intronic
1168119977 19:54246469-54246491 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
1168272978 19:55259934-55259956 GAGCCGAGGCTGCAGTGAGCCGG + Intergenic
1168328415 19:55550836-55550858 GGCCCAAGGATGGAGTGTGATGG - Intergenic
925151066 2:1615161-1615183 GGGGCCAGGGTGCAGAGTGCTGG + Intergenic
925385106 2:3456646-3456668 AGGTCAAGGCTGCAGTGACCAGG - Intronic
925914655 2:8596124-8596146 TGGCCAAAGCTGCAGTATTCGGG + Intergenic
925941334 2:8822556-8822578 AGGTCAAGGCTGCAGTGAGCTGG + Intronic
926131989 2:10309102-10309124 AGTTCAAGGCTGCAGTGAGCTGG - Intronic
926547078 2:14255334-14255356 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
926771454 2:16380087-16380109 GGGCAAAGGTTGCAGTGAGCCGG - Intergenic
927752359 2:25680825-25680847 AGGTCGAGGCTGCAGTGAGCTGG - Intergenic
928450925 2:31377979-31378001 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
928470331 2:31568839-31568861 GGGCCAAGGCGGCAGGGGGCTGG + Intronic
929057478 2:37890977-37890999 GGGCTGAGGCAGCAGTGTCCAGG + Intergenic
929258538 2:39839508-39839530 GGGCCATGGCTGCAGTGTTCAGG + Intergenic
929452310 2:42046335-42046357 GGGCCGTGGCTGCAGTCTGCAGG - Intergenic
929507802 2:42542002-42542024 GAGCCAAGGCAGCAGTTTTCTGG + Intronic
929747018 2:44669705-44669727 AGGCTGAGGCTGCAGTGAGCCGG - Intronic
929815160 2:45224737-45224759 GGTCACAGGCTGCAGGGTGCAGG - Intergenic
930146882 2:48016652-48016674 GGGCCATGGTGGCAGTTTGCGGG - Intergenic
930530443 2:52581946-52581968 GGGCGGAGGTTGCAGTGAGCCGG + Intergenic
930792724 2:55351415-55351437 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
931495185 2:62798296-62798318 GGGCAGAGGTTGCAGTGAGCTGG + Intronic
932054807 2:68433100-68433122 GGGCCGAGGCAGCAGGGGGCTGG + Intergenic
932522379 2:72427548-72427570 GGGCCAAGGCAGCAGGGGGCTGG - Intronic
932580312 2:72989100-72989122 AGGCCAAGGCTGCTGTGGGAAGG - Intronic
932672409 2:73749915-73749937 TGGCCCAGGCTGGAGTGTGGTGG + Intergenic
932694747 2:73945965-73945987 GGGCGGAGGTTGCAGTGAGCCGG + Intronic
932899208 2:75678784-75678806 TTGCCCAGGCTGCAGTGTGGTGG + Intronic
933606575 2:84390015-84390037 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
934038037 2:88104912-88104934 GGGCCAAGGCTGCATCCTTCTGG + Intronic
934687544 2:96332948-96332970 GGGCCAGGGCTGCCTTATGCGGG - Intergenic
934730786 2:96655777-96655799 AGTTCAAGGCTGCAGTGAGCCGG - Intergenic
934733936 2:96678192-96678214 GGGCGGAGGTTGCAGTGAGCTGG - Intergenic
934857626 2:97738996-97739018 GGGCCAGGGTATCAGTGTGCTGG - Intronic
935113999 2:100118874-100118896 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
935297986 2:101667132-101667154 AGGTCGAGGCTGCAGTGAGCTGG + Intergenic
935660648 2:105463998-105464020 AGGCGAAGGTTGCAGTGAGCCGG + Intergenic
936051297 2:109225833-109225855 AGGTCAAGGCTACAGTGAGCCGG - Intronic
936345253 2:111670889-111670911 AGGCCACAGCTGCATTGTGCAGG - Intergenic
936954812 2:118013567-118013589 GGGCCGAGGCTGCTGGGCGCTGG - Intronic
937164102 2:119795472-119795494 GGGCCAAGGTGGCAGGGGGCTGG + Intronic
937330138 2:121021452-121021474 GGGCTCAGGCTGCTGAGTGCAGG + Intergenic
937885501 2:126897076-126897098 GGGCGGAGGTTGCAGTGAGCTGG - Intergenic
938228480 2:129637711-129637733 TGGCAGAGGCTGCAGTGAGCCGG - Intergenic
938533683 2:132220673-132220695 GGGCCAAGGCTGGAGTGCAGTGG + Intronic
938599195 2:132820267-132820289 TGGCCCAGGCTGGAGTGTGGTGG + Intronic
938909955 2:135876634-135876656 GGGCCACGGCTACACTGCGCAGG - Intergenic
938993835 2:136656853-136656875 GGGCCAAGTCTAGAGTGTCCTGG + Intergenic
939073082 2:137567236-137567258 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
940579978 2:155565793-155565815 AGGCCGAGGTTGCAGTGAGCCGG + Intergenic
940694341 2:156959717-156959739 GGGCCAAAGCAGCAGGGGGCTGG + Intergenic
940957015 2:159738991-159739013 GGGCCAAGGTAGCAGTGGGCTGG + Intronic
940960104 2:159775978-159776000 AGGCAGAGGCTGCAGTGAGCCGG - Intronic
941130996 2:161650744-161650766 TGGCCAAGGCAGCAGGGGGCTGG - Intronic
941432278 2:165427031-165427053 GGGACAAGGCAGCAGGGGGCTGG - Intergenic
941882159 2:170491982-170492004 AGGCAGAGGCTGCAGTGAGCTGG + Intronic
942179877 2:173370383-173370405 GGGCAAAGGCTGCAGTTAGAGGG + Intergenic
942585127 2:177466638-177466660 GGGCTGAGGCAGCAGGGTGCTGG + Intronic
942617342 2:177807488-177807510 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
943129290 2:183837493-183837515 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
944219787 2:197291438-197291460 AGGCGGAGGCTGCAGTGAGCTGG + Intronic
944971532 2:204998898-204998920 GAGACAAGGTTTCAGTGTGCTGG + Intronic
945290893 2:208126188-208126210 AGGTCGAGGCTGCAGTGAGCTGG + Intergenic
945314453 2:208356582-208356604 AGGCGGAGGCTGCAGTGAGCTGG + Exonic
946195057 2:218027874-218027896 TGGCCCAGCCTGCAGTCTGCAGG - Intergenic
946281200 2:218666756-218666778 AGTCCAAGGCTGCATTGTGGAGG + Intronic
946394593 2:219436717-219436739 GGGCCAAGGCTGGCGTCTCCTGG + Intronic
946577144 2:221087713-221087735 TCACCCAGGCTGCAGTGTGCTGG - Intergenic
946693588 2:222329681-222329703 TCACCCAGGCTGCAGTGTGCTGG + Intergenic
946712479 2:222520658-222520680 AGGCAGAGGTTGCAGTGTGCCGG + Intronic
946824612 2:223664164-223664186 AGGCCAAGGTTGCAGTGAGGTGG + Intergenic
947316632 2:228866245-228866267 GGGCCGAGGCAGCAGGGGGCTGG - Intronic
947537417 2:230948997-230949019 GGGTCAAGGCTGCAGTGAGCTGG + Intronic
947567280 2:231202390-231202412 AGGTCAAGGCTGTAGTGAGCCGG - Intronic
947731192 2:232432622-232432644 GGGCCATGGCAGCAGTGGGATGG - Intergenic
947774014 2:232693533-232693555 AGGTCAGGGCTGCAGTGAGCTGG - Intergenic
948272925 2:236687835-236687857 GGGCAGAGCCTGCAGTGAGCTGG - Intergenic
948336748 2:237214277-237214299 GGGCCAAAGCTGGATTGTACCGG + Intergenic
948712933 2:239836508-239836530 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
948807576 2:240459628-240459650 GGGACAGGGCTGCAGAGTGCAGG + Intronic
948911205 2:241003577-241003599 GGGCTGAGGCTGAAGTGTGCAGG - Intronic
1168847594 20:956160-956182 AGGTCGAGGCTGCAGTGAGCCGG + Intergenic
1169091360 20:2863109-2863131 AGCCCAAGGGTGCAGTGAGCGGG + Intronic
1169162042 20:3389036-3389058 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
1169235063 20:3924335-3924357 GGTCCAAGGCTGCTTTGTACAGG - Intronic
1169238186 20:3949612-3949634 AGGTGAAGGCTGCAGTGAGCTGG + Intronic
1169370577 20:5026121-5026143 AGGTCAAGGCTGCAGGGAGCCGG - Intergenic
1169632407 20:7647782-7647804 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
1169759226 20:9073343-9073365 GGGCCAAGGATGCAGTTTGGTGG + Intronic
1170100601 20:12695565-12695587 GGGCAGAGGTTGCAGTGAGCCGG - Intergenic
1170327794 20:15176114-15176136 GGGCCAAGGCAGCAGGGGGCTGG - Intronic
1170609499 20:17900796-17900818 TTGCCCAGGCTGGAGTGTGCTGG - Intergenic
1170648725 20:18219798-18219820 TGGCCCAGGCTGGAGTGTGATGG - Intergenic
1170929951 20:20760295-20760317 TTGCCAAGGCTGGAGTGTACTGG - Intergenic
1171097656 20:22347304-22347326 GGGCCAAGGCAGGAGCGAGCAGG + Intergenic
1171346014 20:24467188-24467210 TGGCCCAGGCTGCAGTGCACTGG - Intergenic
1171448142 20:25218949-25218971 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
1172107421 20:32524974-32524996 GGGCCAAGGCTGAGCTGAGCAGG - Intronic
1172693629 20:36807126-36807148 GGGCCAGGGCAGCAGGGTGTGGG + Intronic
1172726420 20:37046436-37046458 GTGCCCAGGCTGGAGTGTGGTGG + Intronic
1172985501 20:38984972-38984994 GAGCAAAGTCTGCAGTTTGCAGG - Intronic
1173177191 20:40773339-40773361 AGACGAAGGATGCAGTGTGCTGG - Intergenic
1173207664 20:41007349-41007371 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
1173434887 20:43023696-43023718 GGGCCAGAGCTGAACTGTGCTGG - Intronic
1173641667 20:44607444-44607466 AGGCAGAGGCTGCAGTGAGCCGG - Intronic
1173949268 20:46977761-46977783 GGGGCAGGGCTGCAATGTGTTGG - Intronic
1174718083 20:52781539-52781561 AAGCCAATGCTGCAGTGGGCAGG + Intergenic
1174759347 20:53191591-53191613 AGGCGGAGGCTGCAGTGAGCTGG + Intronic
1175205819 20:57310429-57310451 AGGTCAAGGCTGCAGTGAGCTGG - Intergenic
1175410460 20:58764338-58764360 GGGTCATGCCTGCACTGTGCTGG + Intergenic
1175814958 20:61878528-61878550 GGGACATGGCTGCTGCGTGCTGG - Intronic
1175917023 20:62430695-62430717 GGGGCCAGGCTGCACTGGGCAGG + Intergenic
1176224316 20:63987128-63987150 TGGCCCAGGCTGAAGTGTGGTGG - Intronic
1178641713 21:34349994-34350016 AGGTCAAGGCTGCAGCGAGCTGG - Intergenic
1179218488 21:39386882-39386904 TTGCCAAGGCTGTAGTGTGGTGG + Intronic
1179491272 21:41743114-41743136 GGGCCAAGGCTGCAATCTCGGGG - Intronic
1179575748 21:42307259-42307281 AGGGAAAGGCTGCAGTGTTCAGG + Intergenic
1179787241 21:43737000-43737022 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
1180025816 21:45161487-45161509 GTGCCGAGGCAGCAGGGTGCTGG - Intronic
1180043343 21:45291750-45291772 GGGCGAGGGCTGCAGTGTTGTGG - Intergenic
1180179012 21:46109644-46109666 GGGCCAAGTCAGCAGGGGGCTGG + Intronic
1180781754 22:18524233-18524255 AGGTCGAGGCTGCAGTGAGCTGG + Intergenic
1181079590 22:20405239-20405261 GGGCCAAGGCTGGAAGGTGCAGG - Intronic
1181186109 22:21105117-21105139 AGGTCAAAGCTGCAGTGAGCTGG + Intergenic
1181238638 22:21463576-21463598 AGGTCGAGGCTGCAGTGAGCTGG + Intergenic
1181337029 22:22144454-22144476 GAGCCAAGAAAGCAGTGTGCAGG - Intergenic
1181541442 22:23575098-23575120 GGCACAGGGCTGCAGTGTGTAGG + Intronic
1181551321 22:23640439-23640461 GGCACAGGGCTGCAGTGTGTAGG + Intergenic
1181600790 22:23950781-23950803 AGGTCAAGGCTGCAGTGAGCCGG - Intergenic
1181607722 22:23990554-23990576 AGGTCAAGGCTGCAGTGAGCCGG + Intergenic
1181796941 22:25318222-25318244 GGCACAGGGCTGCAGTGTGTAGG - Intergenic
1181855490 22:25778547-25778569 AGGTCAAGGCTGCAGTAAGCTGG - Intronic
1182453184 22:30433186-30433208 CTGACAAGGCTGTAGTGTGCAGG - Intergenic
1183025013 22:35058418-35058440 AGGCCAAGGCGGCAGGGGGCTGG + Intergenic
1183102144 22:35590782-35590804 GGGCCAGGGCTGGAGGGTGAAGG + Intergenic
1183382841 22:37498970-37498992 GGGCCAGGCCTGCAGTTTGGAGG - Intronic
1183400694 22:37602222-37602244 AGGTCAAGGCTGCAGTTAGCCGG - Intergenic
1183657454 22:39195967-39195989 AGGTCCAGGCTGCAGTGAGCTGG + Intergenic
1183667403 22:39253718-39253740 GGGCCGGGACTGCAGTGGGCAGG + Intergenic
1183709054 22:39491792-39491814 GGGACATGGCAGCAGTGTGCCGG - Exonic
1183853628 22:40613838-40613860 AGGCAAAGGTTGCAGTGAGCCGG + Intronic
1184015620 22:41783748-41783770 AGGCCAAGGCTGCAGTGAGCTGG - Intronic
1184054323 22:42034108-42034130 GGGCCAGGGCGGCAGGGGGCTGG + Intronic
1184080504 22:42216125-42216147 TTGCCCAGGCTGGAGTGTGCAGG + Intronic
1184126221 22:42489193-42489215 AGTCCGAGGCTGCAGTGGGCTGG + Intergenic
1184162120 22:42703019-42703041 CAGCCAAGGCTGCAGTGTGGAGG - Intronic
1184165447 22:42724621-42724643 AGGTCAAGGCTGCAGTGAGTTGG - Intergenic
1185385079 22:50528079-50528101 AGGTCTAGGCTGCAGTGAGCCGG - Intronic
949335516 3:2970514-2970536 AGGTCGAGGCTGCAGTGAGCTGG - Intronic
949496147 3:4634281-4634303 AGGCTGAGGCTGCAGTGAGCCGG - Intronic
950076346 3:10189887-10189909 GTGGCAAGTCTGCAGTGGGCAGG - Intronic
950459238 3:13111403-13111425 GGGCCGAGGCTGCAGCTCGCTGG + Intergenic
952230178 3:31421187-31421209 AGGCGGAGGCTGCAGTGAGCTGG + Intergenic
952942868 3:38456604-38456626 GAGCCCAGGGTGCAGGGTGCTGG + Intronic
952970863 3:38649495-38649517 GGGCCAGGGCTGCCGGGCGCGGG + Intronic
953322929 3:41988462-41988484 TTGCCCAGGCTGGAGTGTGCTGG + Intergenic
953630273 3:44609572-44609594 AGGTCGAGGCTGCAGTGAGCCGG + Intronic
953862610 3:46557929-46557951 GGGCACAGGCAGCTGTGTGCAGG + Intronic
954389070 3:50259560-50259582 GACCCAAGGCTGCAGAGTACTGG - Intergenic
954406088 3:50345740-50345762 GGGCCCAGGCCGCACTGCGCAGG - Exonic
954777392 3:53032298-53032320 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
955270570 3:57494161-57494183 AGGTCAAGGCAGCAGTGAGCAGG + Intronic
956006778 3:64788324-64788346 AGGTCAAGCCTGCAGTGAGCTGG - Intergenic
956810881 3:72862934-72862956 AGGCGAAGGTTGCAGTGGGCTGG - Intergenic
957636285 3:82790493-82790515 GGGCCGAGGCAGCAGGGGGCTGG - Intergenic
957665399 3:83218755-83218777 GGGCCAAGGCGGCAGGGGGCTGG + Intergenic
957959114 3:87227116-87227138 GGGCCACGGCTTCTGTGCGCGGG - Intergenic
958584529 3:96069287-96069309 AGGCTAAGGCAGCAGTGTCCTGG + Intergenic
958795224 3:98700104-98700126 AGGTCGAGGCTGCAGTGAGCTGG - Intergenic
959920775 3:111866086-111866108 AGGCCGAGGTTGCAGTGAGCTGG - Intronic
960588190 3:119340727-119340749 AAGCCAAGGCTGCAGTCTCCAGG + Intronic
960634300 3:119768342-119768364 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
960637862 3:119801753-119801775 TGGCCAAGGCTGCAGTCACCTGG + Intronic
961216392 3:125163802-125163824 AGGCCAAGGATGCAGAGGGCTGG + Intronic
961700120 3:128737411-128737433 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
961944617 3:130672939-130672961 GGGCAAAGGTTGCAGTAAGCCGG + Intronic
962557875 3:136573929-136573951 GGGCCAAGGCTGGAGTGCAGTGG - Intronic
962775918 3:138659445-138659467 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
962786002 3:138768735-138768757 GGGCCAAGGTGGCAGGGGGCTGG + Intronic
963796592 3:149636892-149636914 GGGCAGAGGTTGCAGTGAGCTGG + Intronic
963821929 3:149906719-149906741 AGATCAAGGCTGCAGTGAGCTGG - Intronic
964614544 3:158648636-158648658 TTGCCAAGGCTGAAGTGTGATGG - Intronic
965114997 3:164477586-164477608 GGGCCAAGGTGGCAGAGGGCTGG - Intergenic
965117917 3:164515331-164515353 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
965197974 3:165624026-165624048 GGAGCAAGGCTGCAGGGAGCTGG + Intergenic
967208788 3:187148428-187148450 GGTCAGAGGCTGCAGTGAGCAGG + Intronic
967228811 3:187318502-187318524 GGGTCAAGGCAGCAGTGGGGAGG - Intergenic
967444895 3:189555073-189555095 AGGCCAAGGCGGCAGAGGGCTGG + Intergenic
967959614 3:194910027-194910049 GGTTCGAGGCTGCAGTGAGCTGG - Intergenic
967995517 3:195163464-195163486 GGGGCAAGGCTGCAGTGGACAGG - Intronic
968143026 3:196274038-196274060 GGGCCAAGGCAGAAGGGGGCTGG + Intronic
968144277 3:196285417-196285439 TTGCCCAGGCTGGAGTGTGCTGG - Intronic
968162395 3:196437520-196437542 GTGTCCAGGCTGGAGTGTGCAGG - Intergenic
968465536 4:748267-748289 AGGCAGAGGCTGCAGTGAGCCGG - Intronic
968520709 4:1033590-1033612 GGGCGCAGGCTGCATTGTGAGGG - Intergenic
968542820 4:1176968-1176990 GGCCCAAGGTTGCAGGGGGCTGG + Intronic
968676765 4:1886244-1886266 TGGCCAGGGCTGGAGTGTGGTGG + Intronic
968777273 4:2550474-2550496 GTGCCCAGGCTGCAGTGTAATGG + Intronic
968839605 4:2992912-2992934 AGGTCAAGGCTGCAGTGAGCTGG + Intronic
968995979 4:3946164-3946186 GTGGCCGGGCTGCAGTGTGCGGG + Intergenic
969179173 4:5424150-5424172 GGGCCAAGGTAGCAGGGGGCTGG - Intronic
969285984 4:6202036-6202058 GGGACAAGGAGGCAGTGTGGGGG + Intergenic
969307791 4:6335673-6335695 GGGCCAGGGCTGCAGAGCCCAGG + Intronic
969377720 4:6773905-6773927 AGGTCCAGGCTGCAGTGAGCTGG + Intergenic
970099387 4:12503297-12503319 GGTCCAAGGCTGGACAGTGCAGG + Intergenic
970795024 4:19901507-19901529 TTGCCAAGGCTGGAGTGTGATGG + Intergenic
971028486 4:22611253-22611275 TGGCCCAGGCTGGAGTGTGGTGG + Intergenic
971876897 4:32319115-32319137 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
972075204 4:35079034-35079056 GGGCCAAGGCAGCAGGGGGCTGG - Intergenic
972102950 4:35445546-35445568 GGCCCAAGGCTGCAGAGAGCAGG - Intergenic
972358332 4:38303413-38303435 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
972624469 4:40782797-40782819 AGTTCAAGGCTGCAGTGAGCTGG + Intronic
972693477 4:41422011-41422033 AGGCAAAGGTTGCAGTGAGCTGG + Intronic
973718767 4:53702804-53702826 AGGCCAGGGCTGCAGCGAGCAGG - Intronic
973839854 4:54850268-54850290 AGGCGGAGGCTGCAGTGAGCCGG + Intergenic
973983222 4:56324189-56324211 GGCCCGAGACTGCAGTGTCCAGG + Exonic
974420085 4:61662476-61662498 GGGCCAAGGCAGCAGGCGGCTGG - Intronic
974826185 4:67133779-67133801 TGGCCGAGGTTGCAGTGAGCCGG + Intergenic
975993168 4:80282030-80282052 GGGCGGAGGTTGCAGTGAGCTGG - Intronic
976097877 4:81528293-81528315 GGACCAAGGCAGCAGGGTGCTGG + Intronic
976579736 4:86721806-86721828 GGGTTGAGGCTGCAGTGAGCTGG - Intronic
976734530 4:88296561-88296583 GGGCCAAGGTAGCAGGGGGCTGG + Intergenic
976818573 4:89178593-89178615 AGGTCAAGGCTGCAATGAGCAGG - Intergenic
977252511 4:94704530-94704552 TGGCCCAGGCTGGAGTGTGGTGG - Intergenic
977780657 4:100977163-100977185 GGGCAGAGGTTGCAGTGAGCCGG + Intergenic
978229971 4:106386112-106386134 GGGCCAAGGTGGCAGGGGGCTGG + Intergenic
978428675 4:108609306-108609328 AGGCAGAGGCTGCAGTGAGCTGG - Intergenic
978780482 4:112548009-112548031 AGGTCAAGGCTGCAGTGAGCAGG - Intronic
980450081 4:132959036-132959058 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
980574426 4:134666599-134666621 AGGCCAAGGCAGCAGGGGGCTGG + Intergenic
980671087 4:136008437-136008459 GGGTCAAGGCAGCAGGGGGCCGG - Intergenic
980962069 4:139485026-139485048 GTGGCAAGGCAGGAGTGTGCAGG + Intergenic
980962865 4:139493607-139493629 AAGGCAAGGCTGCAGTGAGCTGG - Intergenic
981182687 4:141764174-141764196 TGGCGGAGGCTGCAGTGAGCCGG + Intergenic
981242365 4:142492973-142492995 GTGCCAAGGCTGCATAGAGCAGG - Intronic
981532453 4:145765423-145765445 AGGCCCAGGATGCAGTATGCTGG - Intronic
981623045 4:146725465-146725487 AGGTCAAAGCTGCAGTGAGCAGG + Intronic
981818803 4:148862499-148862521 GGGCCCAAACTGCAGTGTGTGGG + Intergenic
982015609 4:151150588-151150610 GGTCCAAGAAAGCAGTGTGCTGG + Intronic
982027325 4:151263843-151263865 CGGCCCAGGCTGGAGTGTGGTGG + Intronic
982920429 4:161267295-161267317 GTGCCAAGGCTGCATAGAGCAGG + Intergenic
983323736 4:166227321-166227343 CAGCCAAGGCAGCAGTGGGCTGG - Intergenic
984102185 4:175499584-175499606 GGGCCAAGGCAGCAGTGGGTTGG + Intergenic
985546288 5:510790-510812 AGGCCAGGGCTGCTGGGTGCAGG + Intronic
986006405 5:3672411-3672433 GGGCCATGGCTGGAGTGTGCAGG + Intergenic
987927801 5:24364662-24364684 GAGCCACTGCTGCAGTGTTCAGG - Intergenic
988544707 5:32144547-32144569 TTGCCCAGGCTGCAGTGTGTTGG - Intronic
988577802 5:32444104-32444126 GGGCCAGGCCTGCAGCGGGCCGG + Intronic
989058728 5:37389130-37389152 TGGCCCAGGCTGGAGTGTGGTGG + Intronic
989283996 5:39678211-39678233 AGGTCAAGGCTGCAGTAAGCTGG - Intergenic
989520602 5:42396335-42396357 GGGCCAACGCAGCAGGGGGCTGG - Intergenic
990023678 5:51159771-51159793 GGGCCAAGGCAGCACAGGGCTGG - Intergenic
990083374 5:51944695-51944717 GTCCCAAGGCTGCAGAGAGCAGG - Intergenic
990112956 5:52350565-52350587 AGGTCAAGGCTGCAGTGGGCTGG + Intergenic
990599378 5:57342157-57342179 TTGCCTAGGCTGCAGTGTGACGG + Intergenic
990815845 5:59783986-59784008 AGGTCAAGGCTGCAGTGAGTTGG + Intronic
991230818 5:64331100-64331122 GGGCCTAGGCAGCAGGGGGCTGG - Intronic
991338101 5:65573360-65573382 GGGCGGAGGTTGCAGTGAGCTGG - Intronic
991396565 5:66210092-66210114 AGGCTAAAGCTGCAGTGTGCAGG - Intergenic
992190639 5:74288105-74288127 GTGCCAAGGCTGCAGTCTCTGGG + Intergenic
992349272 5:75912421-75912443 AGGTCAAGGCTGCAGTGGGGTGG + Intergenic
992469368 5:77041525-77041547 TTGCCCAGGCTGCAGTGTGGTGG - Intronic
992796442 5:80258293-80258315 GGGCGGAGGTTGCAGTGAGCCGG - Intergenic
992838980 5:80668512-80668534 GGGCCGAGGCAGCAGGGGGCTGG + Intronic
993542282 5:89166840-89166862 GGGTCAGGGCTGCAGAGTGCAGG - Intergenic
993618092 5:90137117-90137139 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
994191628 5:96875464-96875486 AAGTCAAGGCTGCAGTGAGCTGG + Intronic
995506544 5:112866414-112866436 AGGTCAAGACTGCAGTGTGTTGG - Intronic
995910156 5:117176950-117176972 GGGAAGAGGCTGCAGTGAGCGGG + Intergenic
995926955 5:117386207-117386229 GGGCCAAGGTAGCAGGGGGCTGG - Intergenic
996727637 5:126686728-126686750 GGGCTAAGACTGCAGTGGCCAGG + Intergenic
997116397 5:131130372-131130394 GGGCGGAGCCTGCAGTGAGCCGG - Intergenic
997292406 5:132747413-132747435 CGCCCCAGGCTGCAGTGTTCCGG + Intergenic
997477731 5:134155862-134155884 AGGTCGAGGCTGCAGTGAGCTGG - Exonic
997590086 5:135067048-135067070 GGGTGGAGGCTGCTGTGTGCTGG + Intronic
997851403 5:137336156-137336178 AGGCCAATCCTGCAGTTTGCTGG + Intronic
997852075 5:137342007-137342029 GCGCCAGGGCTGCGGTGTGTGGG + Intronic
997860267 5:137409390-137409412 GGGATAAGGCTGAAGAGTGCTGG + Intronic
998024427 5:138802865-138802887 AGGTCAAGGCTACAGTGAGCTGG - Intronic
998174471 5:139893489-139893511 TGGCCATGGGTGCAGAGTGCTGG - Intronic
998209182 5:140181286-140181308 GGGCAAAGTCTGGAGTGTCCAGG - Intronic
998223256 5:140305336-140305358 AGGCCAAGGCTGCAGTGAGTGGG + Intergenic
998451860 5:142240920-142240942 AGGCAAAGGTTGCAGTGAGCCGG - Intergenic
998458581 5:142292754-142292776 AGGTCAAGGCTGCAGTGAGCAGG + Intergenic
998833052 5:146179667-146179689 AGGTCAAGGCTGCGGTGAGCTGG - Intronic
999307003 5:150525973-150525995 GAGCCAGGCCTGCAGGGTGCTGG - Intronic
999319780 5:150606735-150606757 GAGCCAAGGCTTCAGTGAGGAGG + Intronic
1000867560 5:166533933-166533955 GGGCTGAGGTTGCAGTGAGCTGG - Intergenic
1000945418 5:167417293-167417315 GGGCCAGGGATGGACTGTGCTGG - Intronic
1001042794 5:168348800-168348822 GATCCCAGGCTGCAGTGTGGGGG - Intronic
1001562762 5:172680077-172680099 GGCCCAGCGCTGCTGTGTGCTGG - Intronic
1002099227 5:176849075-176849097 GGGACAGGGCTGGAGTGTGGCGG + Intronic
1002156725 5:177287564-177287586 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
1003082748 6:3035006-3035028 AGTACAAGGCTGCAGTGAGCTGG + Intergenic
1003123280 6:3335536-3335558 GGGACAAGGCCTCAGTGAGCAGG + Intronic
1003224610 6:4192248-4192270 GGGGCAAGGCTGGAGAGTGAGGG - Intergenic
1003426745 6:6002943-6002965 GGGTCTCGGCTGCAGCGTGCGGG + Intronic
1004222430 6:13758378-13758400 TTGCCCAGGCTGCAGTGTACTGG + Intergenic
1004304419 6:14487430-14487452 GGGCCAAGGCAGCAGGGGGCTGG - Intergenic
1004369260 6:15038074-15038096 AGGTCAAGGCTGCAGTGAGCCGG - Intergenic
1004720889 6:18266340-18266362 GGGCCAAGGCGGCAGGTGGCTGG + Intergenic
1004976899 6:20977806-20977828 AGGCGGAGGCTGCAGTGAGCTGG + Intronic
1005241128 6:23829015-23829037 AGGCCGAGGTTGCAGTGAGCCGG - Intergenic
1005557788 6:27006219-27006241 AGGCCGAGGTTGCAGTGGGCTGG - Intergenic
1005880329 6:30053134-30053156 AGGTTAAGGCTGCAGTGAGCTGG - Intergenic
1005966680 6:30731413-30731435 AGGCGAAGGTTGCAGTGAGCTGG + Intronic
1006077579 6:31543800-31543822 GGGTCAAGGCTGCCGTGAGCTGG + Intronic
1006106338 6:31719146-31719168 GGCCCAGGGCTGGAGTGGGCCGG + Exonic
1006265546 6:32919157-32919179 AGGCAGAGGCTGCAGTGTACCGG - Intergenic
1006297821 6:33177837-33177859 GGCCCAGGCCTGCAGTGTGTGGG + Intronic
1006439935 6:34047653-34047675 GGGCCAAGGCTGAGTTGTGGGGG - Intronic
1006463859 6:34179304-34179326 GGGCCAAGGCGGCAGGGGGCTGG + Intergenic
1006856034 6:37133982-37134004 AGGTCGAGGCTGCAGTGAGCCGG - Intergenic
1006904546 6:37524290-37524312 GGGACAAAGCTGCAGTATGGAGG - Intergenic
1007015332 6:38460691-38460713 AGGCAGAGGCTGCAGTGAGCCGG - Intronic
1007214728 6:40228253-40228275 GGGCCGAGGCAGCAGGGGGCTGG - Intergenic
1007429550 6:41768804-41768826 AGGCCCAGGCAGCAGTGTCCTGG + Intergenic
1007578024 6:42938649-42938671 GGGCCAAGGCAGCAGGCGGCAGG + Exonic
1007616069 6:43180361-43180383 GGGCCCAAGTTGCAGTGAGCAGG + Exonic
1007879077 6:45141268-45141290 AGGCGAAGGTTGCAGTGAGCTGG + Intronic
1008656758 6:53622554-53622576 AGGTCATGGCTGCAGTGAGCTGG + Intergenic
1008891535 6:56498211-56498233 TGGCCCAGGCTGCAGTGTAGTGG + Intronic
1008910854 6:56731081-56731103 GGCCCAGGGCTGGGGTGTGCAGG + Intronic
1009021459 6:57951558-57951580 TGGCCCAGGCTGTAGTGTGGTGG - Intergenic
1009167279 6:60356412-60356434 AGATCAAGGCTGCAGTGAGCTGG + Intergenic
1009187947 6:60596266-60596288 AGGCGAAGGTTGCAGTGAGCTGG - Intergenic
1009530269 6:64803721-64803743 GGGCCAGGGCGGCAGAGGGCTGG + Intronic
1010120431 6:72369527-72369549 CGGCTAAAGCTGCAGTCTGCAGG + Intronic
1010423969 6:75705472-75705494 GGGCGGAGGTTGCAGTGAGCTGG + Intronic
1011275149 6:85623522-85623544 TTGCCCAGGCTGGAGTGTGCTGG - Intronic
1011371592 6:86642865-86642887 AGGTCAAGGTTGCAGTGAGCTGG - Intergenic
1012018057 6:93878383-93878405 AGTTCAAGGCTGCAGTGAGCTGG - Intergenic
1012450851 6:99350964-99350986 GGACCAAAGCTGCAGTGCTCTGG + Intergenic
1012721518 6:102752198-102752220 AGGCGAAGGTTGCAGTGGGCCGG + Intergenic
1012749580 6:103140534-103140556 GGGCCGAGGCAGCAGGGGGCTGG + Intergenic
1012979777 6:105817386-105817408 CGGCCGTGGCTGCAGTGGGCTGG - Intergenic
1013064352 6:106669421-106669443 AGGTCAAGGCTGCAGTGAGCAGG - Intergenic
1013215631 6:108024856-108024878 TGGCCAAGGCTGCAGTGCAGTGG + Intergenic
1014225493 6:118841902-118841924 AGGCGGAGGCTGCAGTGAGCTGG - Intronic
1015423424 6:133037616-133037638 AAGTCAAGGCTGCAGTGAGCCGG - Intergenic
1015533987 6:134248519-134248541 AGGCCCAGGTTGCAGTGAGCTGG - Intronic
1015879319 6:137855534-137855556 GAGCCAATGCTGCAATGTGGTGG - Intergenic
1016028207 6:139310762-139310784 AGGCGGAGGTTGCAGTGTGCTGG - Intergenic
1016728207 6:147399919-147399941 AGGCGAAGGTTGCAGTGAGCTGG + Intergenic
1017143724 6:151215314-151215336 AGGCCAAGGTTGCAGTGAGCTGG + Intergenic
1017201249 6:151756918-151756940 AGGCGAAGGTTGCAGTGAGCCGG + Intronic
1017587894 6:155947153-155947175 GGGCCAAGGTGGCAGGGTGTTGG - Intergenic
1017667033 6:156729774-156729796 AGGTCAAGGCTGCAGTGAGTTGG + Intergenic
1018500293 6:164402518-164402540 TGGTCAAGGCTGCAGTGAGCTGG - Intergenic
1018941411 6:168310676-168310698 GGGCCAGGGCTGCAGAGTGCAGG - Intronic
1019064429 6:169284832-169284854 AGGTCAAGGCTGCAGTGAGCTGG + Intergenic
1019205642 6:170359483-170359505 GGGCAGAGGTTGCAGTGAGCAGG - Intronic
1019211399 6:170408222-170408244 GGCACTCGGCTGCAGTGTGCTGG - Intergenic
1019276772 7:180014-180036 AGGCCCAGGCTGCTGTCTGCAGG - Intergenic
1019469163 7:1209130-1209152 TCGCCCAGGCTGGAGTGTGCTGG - Intergenic
1019728657 7:2617463-2617485 GGGGCGAGGCTGCAATGAGCGGG - Intergenic
1019778178 7:2924665-2924687 TTGCCCAGGCTGCAGTGTGATGG + Intronic
1020270905 7:6595099-6595121 GGGCAGAGACTGCAGTGAGCTGG - Intronic
1020649188 7:10854785-10854807 GGGCCAATGCAGCAGGGGGCTGG - Intergenic
1021097192 7:16547709-16547731 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
1021454449 7:20814233-20814255 AGGCAAAGGTTGCAGTGAGCTGG + Intergenic
1021591076 7:22262893-22262915 TGGTCAAGGCTGTAGTGAGCCGG + Intronic
1021596444 7:22322203-22322225 AGGTCAAGGCTGCAGTGAGCTGG - Intronic
1021764998 7:23939849-23939871 AGGTCAAGGTTGCAGTGAGCTGG + Intergenic
1022226515 7:28368974-28368996 AGGTCAAGGCTACAGTGAGCTGG + Intronic
1022376223 7:29813988-29814010 TGGTCGAGGCTGCAGTGAGCTGG - Intronic
1023626148 7:42117010-42117032 GGGCCAAGGCTACAACATGCTGG + Intronic
1023885098 7:44348734-44348756 GGGCCAAGGGAGCAAAGTGCAGG + Intergenic
1023966459 7:44965405-44965427 GGTCCAGGGCTGCAGCCTGCAGG - Intronic
1023983657 7:45083191-45083213 GGTCCAAGGCTGCAGGCTCCGGG + Exonic
1024024506 7:45399506-45399528 AGGCCAAGGCAGCAGGGGGCTGG - Intergenic
1024388898 7:48784688-48784710 TTGCCTAGGCTGGAGTGTGCTGG + Intergenic
1024487142 7:49931850-49931872 GGCCCTAGGCTGCAGAGAGCAGG - Intronic
1024723073 7:52159974-52159996 GGGCCAAGGCTGAGATGGGCAGG + Intergenic
1026602158 7:71785818-71785840 GGGGCAGGCATGCAGTGTGCAGG + Exonic
1026805032 7:73424116-73424138 AGGCCCAGGCTGCAGGGAGCTGG + Intergenic
1026942649 7:74296438-74296460 AGGCAGAGGCTGCAGTGAGCTGG + Intronic
1027445229 7:78266268-78266290 AGGTCAAGACTGCAGTGAGCCGG - Intronic
1027734991 7:81920729-81920751 GGGCCAAGGCAGCAGAAGGCTGG + Intergenic
1028136704 7:87230388-87230410 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1028305169 7:89254683-89254705 GGGCCCAGGCTGGAGTGTGGTGG + Intronic
1028596070 7:92547248-92547270 GGGCCAAGTCAGCAGGGGGCTGG - Intergenic
1028640726 7:93039629-93039651 GGGCCAAGGCAGCAGGGGGCTGG - Intergenic
1029104783 7:98166066-98166088 GGGCCAAGGCCGTAGTGCCCGGG - Intronic
1030131574 7:106206231-106206253 GGGCCGAGACTGCAGTGAGCCGG - Intergenic
1030243741 7:107359322-107359344 GGGCCAAGGTGGCAGAGGGCTGG - Intronic
1030287136 7:107838253-107838275 AGTTCAAGGCTGTAGTGTGCTGG - Intergenic
1030321411 7:108172363-108172385 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
1030570220 7:111213277-111213299 GGGCTGAGGCAGCAGGGTGCTGG - Intronic
1030721878 7:112881188-112881210 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
1031786506 7:126040661-126040683 GGGCCAAGGCGGCAGGGGGTTGG - Intergenic
1031924971 7:127630455-127630477 AGGTCAAAGCTGCAGTGAGCTGG + Intergenic
1031944628 7:127826149-127826171 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1032054237 7:128672023-128672045 ATGCCAAGGCAGCAGTGAGCTGG - Intergenic
1032084488 7:128876926-128876948 GGGCCCAGGCTCCAGTGTCCAGG + Exonic
1032591256 7:133194131-133194153 GGGCCAAGGTGGCAGGGAGCTGG + Intergenic
1033113766 7:138606882-138606904 AGGCAGAGGTTGCAGTGTGCTGG + Intronic
1033146875 7:138878690-138878712 AGGTCGAGGCTGCAGTGAGCCGG + Intronic
1033235356 7:139633873-139633895 AGGCAGAGGCTGCAGTGAGCCGG + Intronic
1033647532 7:143316711-143316733 GAGCCCACACTGCAGTGTGCTGG + Intronic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1034719634 7:153278542-153278564 AGGCGGAGGCTGCAGTGAGCCGG + Intergenic
1035265104 7:157685873-157685895 GGGCCTAGGCAGCAGGGAGCCGG - Intronic
1035391428 7:158507260-158507282 GGGATAGCGCTGCAGTGTGCAGG + Intronic
1035391542 7:158507858-158507880 GGGATAGCGCTGCAGTGTGCAGG + Intronic
1035713469 8:1736550-1736572 TCGCCCAGGCTGCAGTGCGCTGG - Intergenic
1036045513 8:5135615-5135637 GTGCCCAGGCTGCAGTGGGGTGG + Intergenic
1036613839 8:10373434-10373456 AGTTCAAGGCTGCAGTGAGCAGG - Intronic
1036656764 8:10681947-10681969 CCGCCAAGGCTGCTGTGGGCAGG - Intronic
1036765233 8:11545841-11545863 GGGCAAAGGCAGCAGAGGGCGGG + Intronic
1037307293 8:17518930-17518952 GGGAGAAGGCTGCCGTCTGCAGG - Intronic
1037414666 8:18637001-18637023 GGGAGAAGGCTGGAATGTGCTGG - Intronic
1037608395 8:20456515-20456537 AAGTCAAGGCTGCAGTGAGCTGG - Intergenic
1037884190 8:22587824-22587846 TGGCCAAGGCTGCAGAGAGCTGG + Intronic
1039157581 8:34579129-34579151 GTGCCCAGGCTGGAGTGTGGTGG + Intergenic
1039215302 8:35263462-35263484 AGTTCAAGGCTGCAGTGAGCTGG - Intronic
1039828638 8:41195401-41195423 GGGCAGAGGCTGGTGTGTGCAGG - Intergenic
1039869708 8:41535266-41535288 AGGCAGAGGCTGCAGTGAGCTGG + Intronic
1042529702 8:69802434-69802456 AAGTCAAGGCTGCAGTGAGCTGG + Intronic
1042560297 8:70069051-70069073 GAGCTGAGGCTGCAGAGTGCGGG - Intronic
1042594242 8:70428552-70428574 AGGTCAAGGCTGCGGTGAGCTGG + Intergenic
1042625035 8:70748493-70748515 GAGCCAAGGTTGCAGGGGGCTGG - Intronic
1043014462 8:74920800-74920822 AGGTCAAGGCTGTAGTGAGCTGG + Intergenic
1043533094 8:81171858-81171880 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
1044053817 8:87542899-87542921 GGGCCGAGGCAGCAGAGAGCTGG + Intronic
1044061637 8:87644526-87644548 GGGCCGAGGTGGCAGTGTGGGGG + Intergenic
1044407048 8:91839608-91839630 AGGCAAAGGTTGCAGTGAGCTGG - Intergenic
1044613839 8:94119819-94119841 GGGCCGAGGCAGCAGGGGGCTGG - Intergenic
1044658531 8:94572849-94572871 AGATCAAGGCTGCAGTGAGCTGG + Intergenic
1045153883 8:99444166-99444188 AGGCGGAGGCTGCAGTGAGCCGG - Intronic
1045917023 8:107484469-107484491 AGGTCGAGGCTGCAGTGAGCTGG - Intronic
1046940987 8:119931139-119931161 AGGCAGAGGCTGCAGTGAGCCGG + Intronic
1047376297 8:124300693-124300715 GGGCGGAGCCTGCAGTGAGCCGG - Intergenic
1048421765 8:134284328-134284350 GGGCCAAGGTGGCAGGGTGCTGG + Intergenic
1049085440 8:140474797-140474819 AGGCAGAGGCTGCAGTGAGCTGG + Intergenic
1049140427 8:140949608-140949630 GGGCCAGGGCGGCAGGGGGCTGG - Intronic
1049171900 8:141166806-141166828 GGGCCAGGGCTAAAGTGAGCAGG + Intronic
1049231350 8:141485582-141485604 AGTTCAAGGCTGCAGTGAGCTGG - Intergenic
1049336816 8:142091009-142091031 GGGCCAGGACTGCAGGATGCTGG + Intergenic
1049368248 8:142251235-142251257 GGGGGCAGGCTGCGGTGTGCAGG - Intronic
1049451253 8:142663081-142663103 AGGTCGAGGCTGCAGTGAGCTGG + Intronic
1049648174 8:143746450-143746472 AGGTCGAGGCTGCAGTGAGCTGG - Intergenic
1049688466 8:143948697-143948719 GGGCCAAGAGTGGGGTGTGCTGG - Intronic
1050112249 9:2229011-2229033 AGGTCAAGGCTGCAGTGAGCCGG - Intergenic
1050276834 9:4009436-4009458 GGGCCATGGCTGCACCTTGCTGG - Intronic
1050483925 9:6114436-6114458 GGGCCAAGGTGGCAGGGGGCTGG - Intergenic
1050743363 9:8848403-8848425 AGATCAAGGCTGCAGTGAGCTGG - Intronic
1050947889 9:11549563-11549585 GGGCAAAGGCAGCAGAGGGCTGG - Intergenic
1051350040 9:16190642-16190664 AGGTCAAGGCTGCAGTGAGCTGG - Intergenic
1051355110 9:16233917-16233939 GGGCCAAGGTGGCAGAGGGCTGG - Intronic
1051685877 9:19657795-19657817 AGTCCAAGTCTGCAGTGGGCTGG - Intronic
1052846420 9:33340315-33340337 GGGCCAAGGCTTCAGAGTGCAGG - Intronic
1052937143 9:34102218-34102240 AGGTCAAGGGTGCAGTGAGCTGG + Intronic
1052946085 9:34169302-34169324 AGGTCGAGGCTGCAGTGAGCTGG - Intergenic
1053173762 9:35908227-35908249 GGGGCAGGGCTGCAGGGAGCAGG - Intergenic
1053352443 9:37422659-37422681 GGGGCCAGGCTGGAGTGGGCGGG - Exonic
1053423570 9:37996631-37996653 GGGCCAAGGTTGGAGCCTGCTGG + Intronic
1054784803 9:69200425-69200447 TTGCCAAGGCTGGAGTGTGGTGG + Intronic
1054909082 9:70437653-70437675 AGGTCAAGCCTGCAGTGAGCCGG - Intergenic
1055095217 9:72406398-72406420 AGGCAAAGGTTGCAGTGAGCTGG - Intergenic
1055220101 9:73918818-73918840 GGGCAAAGGCTACAGCTTGCAGG + Intergenic
1055703311 9:78970532-78970554 GGGCCACGGGAGCAGTGTGGAGG - Intergenic
1055960782 9:81818279-81818301 CCGCCCAGGCTGCAGTGTGAGGG + Intergenic
1056218223 9:84425700-84425722 GAGTCAAGGCTGCAGTGAGCGGG - Intergenic
1056838878 9:89981735-89981757 TCGCCCAGGCTGGAGTGTGCTGG + Intergenic
1056957675 9:91095654-91095676 GGGTCATGGCTGCAGCTTGCTGG + Intergenic
1057016877 9:91659629-91659651 AGGACAGGGCTGAAGTGTGCTGG + Intronic
1057212755 9:93209654-93209676 GGAACAAGGCTGCAATGTGGTGG + Intronic
1057371837 9:94480417-94480439 CCGCCGAGACTGCAGTGTGCTGG + Intergenic
1057488510 9:95505643-95505665 GGGGGAAGGCTGCATTTTGCAGG - Intronic
1057510879 9:95678661-95678683 GAGCCAAGGCAGCAGAGAGCTGG + Intergenic
1057547904 9:96031794-96031816 GGGTCAAGTCTGCAGTGCCCAGG - Intergenic
1057557362 9:96098598-96098620 AGGCCAAGGCTGCAGTGAGCAGG + Intergenic
1058091854 9:100814179-100814201 GAGCCAAGGCAGCAGGGGGCAGG - Intergenic
1058510692 9:105713493-105713515 GGGCCAAGGTGGCAGGGGGCTGG - Intronic
1058688974 9:107503311-107503333 TCGCCAAGGCTGGAGTGTGGTGG + Intergenic
1058923715 9:109641337-109641359 GAGCCAGGGCTGCAATGTCCTGG + Intronic
1059104725 9:111501553-111501575 GGGTCAAGGCTGCAGGAGGCTGG - Intergenic
1059681474 9:116590408-116590430 GGGCCAAGGCAACAGGGGGCTGG - Intronic
1059930533 9:119255883-119255905 AGGCGGAGGCTGCAGTGAGCCGG + Intronic
1060290212 9:122295513-122295535 AGGCGCAGGCTGCAGTGAGCTGG - Intronic
1060389041 9:123263483-123263505 TGGCCCAGGCTGGAGTGTGGTGG - Intronic
1060468620 9:123929814-123929836 GGGCCAGGGCTGCAGGCCGCGGG - Intronic
1060584259 9:124776558-124776580 AGGTCAAGGCTGTAGTGAGCTGG + Intergenic
1060717082 9:125942289-125942311 GGGCCCAGGCTGCAGAGTGCTGG + Intronic
1060817538 9:126643035-126643057 GAGCTGAGGCTGCAGTGGGCAGG + Intronic
1060915629 9:127388074-127388096 AGGTCAAGGCTGCATTGAGCCGG + Intronic
1061041604 9:128144102-128144124 GGCCCAAGGCTGCAGGGCACAGG - Intergenic
1061254066 9:129443695-129443717 AGGTCAAGGCTGCAGTGAGCTGG - Intergenic
1061597080 9:131637967-131637989 GGGCCAGGGCTGCAGGCAGCAGG - Intronic
1062016617 9:134294332-134294354 TGGACAAAGCTGCAGTGCGCCGG - Intergenic
1062322624 9:135997889-135997911 AGTCCCAGGCTGGAGTGTGCAGG - Intergenic
1062329067 9:136028908-136028930 GGGCCAAGGCGGCAGGGGCCTGG - Intronic
1062369120 9:136227907-136227929 AGGCACAGGCTGCAGTGAGCCGG + Intronic
1062371066 9:136239001-136239023 CAGCCAAGACTGCAGTGTCCAGG - Intronic
1062451820 9:136618944-136618966 GGGCCAAGGAGGGAGTGTGAGGG + Intergenic
1062498146 9:136841231-136841253 GGGCCCAGGCTGCCGTGGGTTGG + Intronic
1062541368 9:137043126-137043148 GGGGCAGCGCTGCCGTGTGCAGG - Intronic
1062599371 9:137313080-137313102 GGTCCAAGGGTGTTGTGTGCAGG - Intronic
1062656827 9:137608020-137608042 TCGCCCAGGCTGGAGTGTGCCGG + Intronic
1062729973 9:138103322-138103344 GGGCCCAGGCTGCAGTCTCCAGG + Intronic
1185481497 X:449869-449891 AGGCTGAGGCTGCAGTGAGCTGG - Intergenic
1185871273 X:3666866-3666888 TTGCCCAGGCTGCAGTGTACTGG - Intronic
1186370684 X:8944051-8944073 AGGTCAAGGCTGCAGTGAACTGG - Intergenic
1187416920 X:19101629-19101651 AGGCCAAGGCTGCAGTGAGCTGG + Intronic
1187420045 X:19126033-19126055 AGGTCAAGGCTGCAGTGAGCCGG + Intergenic
1187541618 X:20202047-20202069 GGGCGGAGGTTGCAGTGAGCCGG - Intronic
1187912404 X:24122953-24122975 AGGTCATGGCTGCAGTGAGCTGG - Intergenic
1187955978 X:24519437-24519459 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
1188487985 X:30704199-30704221 AGGTCAAGGTTGCAGTATGCTGG - Intronic
1189390615 X:40573200-40573222 AGGCGGAGGCTGCAGTGAGCCGG + Intergenic
1189452004 X:41144287-41144309 AGGCCAAGGTTGCAGTGAGCCGG - Intronic
1190108300 X:47574115-47574137 GGGCCGAGGCTGCTGCGTGGTGG + Exonic
1190211848 X:48455164-48455186 AGTTCAAGGCTGCAGTGAGCTGG - Intergenic
1190222739 X:48522740-48522762 AGGCAGAGGCTGCAGTGAGCCGG - Intronic
1190236633 X:48621388-48621410 GGGCAGAGGTTGCAGTGAGCCGG - Intergenic
1192237981 X:69308012-69308034 CGGCCAGGGCTGAAGTGGGCGGG + Intergenic
1192317516 X:70064109-70064131 AGGCGGAGGCTGCAGTGGGCCGG + Exonic
1192460717 X:71314691-71314713 AGGCAGAGGCTGCAGTGAGCCGG + Intergenic
1192501658 X:71657961-71657983 AGGTCAAGGCTGCAGTGAGTCGG + Intergenic
1192528057 X:71864586-71864608 AGCTCAAGGCTGCAGTGGGCTGG + Intergenic
1192773868 X:74221772-74221794 AGGCGGAGGCTGCAGTGAGCTGG + Intergenic
1193246579 X:79237151-79237173 GTTCCAAGGCTGCAGAGAGCAGG + Intergenic
1193554089 X:82932346-82932368 GGACCAAGGCAGCAGGGAGCTGG - Intergenic
1194027731 X:88774475-88774497 CTGCCAAGGCTGGAGTGTGGTGG - Intergenic
1194195173 X:90883358-90883380 GTGGGAAGGCTGCACTGTGCTGG + Intergenic
1194721139 X:97341302-97341324 TTGCCAAGGCTGGAGTGTGGTGG - Intronic
1195803397 X:108736440-108736462 GGGCCAAGGCAGGAGGGGGCTGG - Intergenic
1196782949 X:119399440-119399462 GGCCAAAGGCTGCTGTGCGCTGG + Exonic
1196844897 X:119890029-119890051 AGGCAAAGGTTGCAGTGAGCCGG - Intergenic
1196883716 X:120223608-120223630 GGGCCAAGGCAGCAGGGCACTGG + Intergenic
1197119213 X:122870207-122870229 TGTCCAAGGCTGCAGTGAGCTGG - Intergenic
1197342141 X:125287354-125287376 GGGCCAAGGCAGCAAGGGGCTGG - Intergenic
1197757258 X:130004282-130004304 TGGCCCAGGCTGGAGTGCGCTGG + Intronic
1198077215 X:133205134-133205156 TTGCCCAGGCTGCAGTGTGATGG - Intergenic
1198079537 X:133226430-133226452 GAGCCAAGATTGCAGTGAGCCGG - Intergenic
1198463502 X:136884682-136884704 GGGCGGAGGTTGCAGTGAGCTGG - Intergenic
1198739120 X:139822264-139822286 AGGCAGAGGCTGCAGTGAGCTGG - Intronic
1200068872 X:153518098-153518120 GGGCGCAGGGTGCAGGGTGCGGG - Intronic
1200141069 X:153903302-153903324 GGGGGCAGGCTGCAGAGTGCTGG - Intronic
1201375923 Y:13318961-13318983 GTCCCCAGGCTGCAGTGTGATGG - Intronic