ID: 1109782525

View in Genome Browser
Species Human (GRCh38)
Location 13:67130664-67130686
Sequence TTCCTATGATGAGGCAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 2, 1: 5, 2: 9, 3: 25, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109782525_1109782528 -5 Left 1109782525 13:67130664-67130686 CCAGAACTGCCTCATCATAGGAA 0: 2
1: 5
2: 9
3: 25
4: 168
Right 1109782528 13:67130682-67130704 AGGAACATCTTATCAAACAAGGG 0: 1
1: 0
2: 4
3: 17
4: 233
1109782525_1109782529 16 Left 1109782525 13:67130664-67130686 CCAGAACTGCCTCATCATAGGAA 0: 2
1: 5
2: 9
3: 25
4: 168
Right 1109782529 13:67130703-67130725 GGCCAGAACTGCCTCATCATAGG 0: 6
1: 13
2: 11
3: 20
4: 129
1109782525_1109782527 -6 Left 1109782525 13:67130664-67130686 CCAGAACTGCCTCATCATAGGAA 0: 2
1: 5
2: 9
3: 25
4: 168
Right 1109782527 13:67130681-67130703 TAGGAACATCTTATCAAACAAGG 0: 1
1: 0
2: 2
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109782525 Original CRISPR TTCCTATGATGAGGCAGTTC TGG (reversed) Intronic
900708549 1:4095887-4095909 TTCCTCTGAGGAGGCAGGTGTGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
905658388 1:39701203-39701225 TTCCCATGCTGAGGCGGTTTTGG + Intronic
907895656 1:58687735-58687757 TTCCCATGATGAGGCAGTTCTGG - Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912556065 1:110516947-110516969 TTCCTATGAAGGGATAGTTCAGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
917453936 1:175169921-175169943 CTCCTAGGATGTGTCAGTTCCGG + Intronic
918289807 1:183096021-183096043 TTCCTATGATAAGTCAATTTTGG + Intronic
918579757 1:186111954-186111976 TACCTAAGATGAAGCATTTCAGG - Intronic
922563347 1:226585299-226585321 GTCCTCTGAGGAGGCAGTGCTGG - Intronic
1065747108 10:28852453-28852475 TCCTTATCATGAGACAGTTCAGG + Intronic
1067833756 10:49625340-49625362 CTGCCATGATGATGCAGTTCTGG + Intronic
1071839988 10:89460181-89460203 TTCCCATGATGAAAGAGTTCTGG - Intronic
1071844484 10:89507165-89507187 TTGCTATGTTGGGGAAGTTCTGG - Intronic
1072876349 10:99176711-99176733 TTGCTAGGTTGAGGAAGTTCTGG - Intronic
1073470240 10:103717609-103717631 TTCCCAGGAGGATGCAGTTCTGG - Intronic
1075200462 10:120398913-120398935 TTGGTATGATGAGAGAGTTCTGG + Intergenic
1077907971 11:6548351-6548373 TTCCTTTGATGTGGCTGCTCAGG - Exonic
1077960347 11:7070489-7070511 TTCCTATAATGAGGGATTTGGGG + Intronic
1078559927 11:12362604-12362626 TTACTGTGATGTGGCAATTCTGG - Intergenic
1079653866 11:22964457-22964479 TTGCTAGGTTGAGGAAGTTCTGG + Intergenic
1079966221 11:26983457-26983479 TTGCTAGGTTGAGGAAGTTCCGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082900290 11:58242017-58242039 TTCCTGGGATGAGATAGTTCAGG - Intergenic
1083136593 11:60683961-60683983 TTCCCATGATGAGGTGGTTCTGG + Intergenic
1083780106 11:64913373-64913395 GTACTGTGATGAGGCAGTGCGGG - Exonic
1084465076 11:69318287-69318309 TTACTAAGATGAGGCTTTTCTGG + Intronic
1085693644 11:78685951-78685973 TTCTAATGTTGAGGCACTTCAGG + Intronic
1086585651 11:88448512-88448534 TTCCCATAATGAGGCAGTTCTGG - Intergenic
1087193773 11:95284310-95284332 AGCCTCTGATGAGGGAGTTCAGG + Intergenic
1087306796 11:96498988-96499010 TTCCCATGATGAGGCAGTTCTGG - Intronic
1087308091 11:96507285-96507307 TTCCCATGATGAGGCAGTTCTGG - Intronic
1087379637 11:97387980-97388002 TTCCTTTCATTAGGCAGATCTGG - Intergenic
1087993604 11:104776718-104776740 TTCCTATGATGAACCAGTTTAGG + Intergenic
1089061136 11:115627193-115627215 TTCTTAAGATGAGGAAATTCAGG + Intergenic
1089350033 11:117816933-117816955 TTCCTCTGATGGGGAAGTCCAGG + Intronic
1089653593 11:119931374-119931396 ATCCTATGCTGAGGAGGTTCTGG + Intergenic
1090242928 11:125196686-125196708 TTCTAATGATGAGGAAATTCAGG - Intronic
1091108109 11:132942090-132942112 TCCCTTTAATGAGGCAGTTCTGG - Intronic
1091191812 11:133701889-133701911 TTCCTGTGATGGGGAAGTGCTGG - Intergenic
1091252747 11:134157215-134157237 TTCTTATAAAGAGGCAATTCAGG + Intronic
1091830330 12:3544662-3544684 TTCCCGTGATGAGGCGGTTCTGG + Intronic
1092094841 12:5832976-5832998 TCCATATGATGAGGCAATTAAGG + Intronic
1092560903 12:9611901-9611923 TTGCTATGTTGGGGAAGTTCTGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097219620 12:57440658-57440680 TGCCTACGATAAGGCATTTCGGG - Intronic
1098109962 12:67111579-67111601 TTCCTAAGAGGAGCCAGATCAGG + Intergenic
1099192769 12:79577373-79577395 TTCTTATGTTGAGGCAGTTGAGG - Intronic
1099542023 12:83923331-83923353 TTCACATGATGAGGAAGTACAGG - Intergenic
1100246394 12:92762141-92762163 TTCCTTTGCTTAGGCAGGTCAGG - Intronic
1101114876 12:101522310-101522332 TGCATATGATGATGCAGTTTGGG - Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104216176 12:126735979-126736001 TTCCCACAATGAGGCAGTTGGGG + Intergenic
1104515611 12:129423372-129423394 TTCCTCTGACAAGGCAGTGCAGG - Intronic
1106974082 13:35185325-35185347 TCCATATGATTAGGCAGTTATGG - Intronic
1107305139 13:39010702-39010724 TTTCTATAAGGATGCAGTTCTGG + Exonic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109691956 13:65906398-65906420 TGCATATGTTGAGCCAGTTCTGG + Intergenic
1109782525 13:67130664-67130686 TTCCTATGATGAGGCAGTTCTGG - Intronic
1109782530 13:67130705-67130727 TTCCTATGATGAGGCAGTTCTGG - Intronic
1110279030 13:73671193-73671215 TGCCTTTGATGAGTCAGTACAGG + Intergenic
1110433814 13:75457673-75457695 TTCTTGTGATTAGGCAGTTTGGG - Intronic
1112171891 13:96982176-96982198 TACCTATGATTATTCAGTTCTGG + Intergenic
1113473520 13:110563059-110563081 TTCTGAGGATGAGGCAGTGCTGG - Intergenic
1117864878 14:60136739-60136761 CTCCCATGATGAGGTGGTTCTGG + Exonic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1125367733 15:38936885-38936907 TTTCTATGTTGAAGCAGTTCTGG + Intergenic
1129091859 15:73159477-73159499 TTCCTATACTGAGACAGTTTAGG + Intronic
1130008339 15:80125174-80125196 TTCTTATGATTAGACAGTTGTGG + Intronic
1131734652 15:95319201-95319223 TTCCCATTATGATGCAGGTCGGG + Intergenic
1134036823 16:11037374-11037396 TTCCTTTCATGAGGAAGTTAAGG - Intronic
1138213183 16:55180248-55180270 TTCCTAGGATGAGGCAAGTCAGG + Intergenic
1138298018 16:55903281-55903303 GTCCTTTTATGAGGCAGTTATGG - Intronic
1140251707 16:73300291-73300313 TTTCTATAATGGGGCATTTCAGG - Intergenic
1141076292 16:81008787-81008809 TGACTATAGTGAGGCAGTTCTGG + Intronic
1143545610 17:7593388-7593410 TGCCTATGGTGAGACAGTTATGG - Exonic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145869405 17:28261072-28261094 TTCCCACGATGTGGCTGTTCTGG - Intergenic
1146753096 17:35400073-35400095 TTCCCAGGATGAGGTGGTTCTGG + Intergenic
1147922877 17:43929132-43929154 TTCCCATGATGAGGTGCTTCTGG + Intergenic
1148686619 17:49504637-49504659 TTCCTAGGAGCAGGCAGATCTGG - Intronic
1149376065 17:56045391-56045413 TTCCTCTGAGGAAGCAGTTAAGG + Intergenic
1152455494 17:80413842-80413864 TTCCCAGGATGAGGTGGTTCCGG - Intergenic
1153304345 18:3618635-3618657 TAGCTATGACAAGGCAGTTCTGG + Intronic
1153909727 18:9696333-9696355 TTCCCATGATGAGGCGGTTCTGG - Intergenic
1154270480 18:12913910-12913932 TTCCTGGGATGAGATAGTTCTGG + Intronic
1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG + Intergenic
1156457648 18:37303767-37303789 ACCCTCTGATGAGGCAGGTCTGG + Intronic
1156483986 18:37453286-37453308 TGAATATGATAAGGCAGTTCAGG + Intronic
1156953358 18:42932124-42932146 TTTCTATCATGAGGGAGTGCTGG - Intronic
1162087622 19:8258039-8258061 TACCAATGGTGAGGCAGTCCTGG - Intronic
1162118487 19:8446253-8446275 TTCCGATGATGAAAAAGTTCTGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165881493 19:39047232-39047254 CTCCCATGATAAGGCAGTTCTGG - Intergenic
1166957196 19:46472432-46472454 GTTCCATGATGAGGCGGTTCTGG - Intergenic
1168366350 19:55791326-55791348 TTCCTTTGACAAGGCAGTTTAGG - Intronic
925836245 2:7949861-7949883 TTCCTTTAATAAGGCAGTCCTGG - Intergenic
930774859 2:55161566-55161588 TTCCCCTGGTGGGGCAGTTCAGG - Intergenic
931200514 2:60093034-60093056 TTCCTATCATGTGGCATTCCCGG + Intergenic
931269962 2:60692813-60692835 TTGCAATGATGAACCAGTTCTGG + Intergenic
935382147 2:102463829-102463851 TGCCTGTGACAAGGCAGTTCAGG + Intergenic
937423531 2:121778261-121778283 TTCCCGTGATGAGGTGGTTCTGG - Intergenic
938224128 2:129601124-129601146 TTGCTAGGTTGAGGAAGTTCTGG + Intergenic
939962344 2:148576325-148576347 TTCCTATGGTGTGGCCCTTCGGG + Intergenic
941403613 2:165061781-165061803 TTCCCATGATGAGGCGGTTCTGG + Intergenic
941509712 2:166390497-166390519 TTCCTATGATGAGAGAGCTAGGG - Intergenic
943540711 2:189210509-189210531 TTCCTATGATGCTGCAATTCTGG - Intergenic
944553387 2:200865520-200865542 TTCCCATAATGAGGCGGTTCTGG + Intergenic
944878367 2:203985944-203985966 TTCCTCTGATGGGGCAGCTTGGG + Intergenic
946172180 2:217902159-217902181 TTCCTCTGAGGGGGCAGTTTTGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1172244870 20:33438877-33438899 TACCCATGATGAGGCGGTGCAGG - Exonic
1176342084 21:5708535-5708557 TTGCTATGATGAGGTTTTTCAGG + Intergenic
1176474338 21:7140687-7140709 TTGCTATGATGAGGTTTTTCAGG + Intergenic
1176502743 21:7615921-7615943 TTGCTATGATGAGGTTTTTCAGG - Intergenic
1176536405 21:8106604-8106626 TTGCTATGATGAGGTTTTTCAGG + Intergenic
1178368040 21:32003904-32003926 TTCCAATAATGAGGCATTTGGGG + Exonic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179458332 21:41515167-41515189 TTCCTAGGTAGAGGCAGTTCTGG + Intronic
1182693466 22:32179562-32179584 TTCCTGGGAGGAGGCAGCTCTGG - Intergenic
1185190479 22:49433161-49433183 TTCTCATGATGGGGCAGTACTGG - Intronic
1185190527 22:49433365-49433387 TTCTCATGATGGGGCAGTACTGG - Intronic
1185190591 22:49433610-49433632 TTCTCATGATGGGGCAGTACTGG - Intronic
1203241351 22_KI270733v1_random:23016-23038 TTGCTATGATGAGGTTTTTCAGG + Intergenic
949388786 3:3536182-3536204 TTCTCATGAGGAGGCAGTTTTGG + Intergenic
950945127 3:16937446-16937468 TTTCTATGGTGAGTCAGTTATGG + Intronic
951535859 3:23740167-23740189 TACTTATGATTAGGCTGTTCTGG + Intergenic
951608184 3:24460701-24460723 TTTCTATGACCAGGCAGTTCTGG - Intronic
956940452 3:74154382-74154404 TTGGTATGATGAAGAAGTTCTGG + Intergenic
959524014 3:107355872-107355894 TTCCAATGATGAGGCGGTTCTGG - Intergenic
960940800 3:122932563-122932585 TTCCCATGATGAGGCAGTTCTGG - Intronic
962297740 3:134207747-134207769 TTCCTATGATCAAGAAGTTTGGG + Intronic
965219629 3:165911973-165911995 TTTCAATGATGAGCCAGTTTGGG - Intergenic
965415484 3:168387557-168387579 TTCCCATGATGAGGCGGTTCTGG + Intergenic
969454585 4:7294196-7294218 AGCCCATGATGAGGCAGTGCCGG + Intronic
969894753 4:10293045-10293067 TTCCCATGAGGAGGCGGTTCTGG - Intergenic
975894992 4:79078472-79078494 TTCCCATGTTGAGGCAGTTCTGG + Intergenic
976310517 4:83607425-83607447 TTTCTATCATGAAGCAGTTTAGG - Intergenic
980894762 4:138851481-138851503 TAATTGTGATGAGGCAGTTCTGG - Intergenic
981668043 4:147253257-147253279 TTTCTGTCATGAGGCAGTTTTGG - Intergenic
982610352 4:157566488-157566510 TTCCTATGAGGTAGCAGTTTAGG + Intergenic
982821703 4:159948463-159948485 CTTCTAAAATGAGGCAGTTCTGG + Intergenic
987559735 5:19504525-19504547 TTCCTCAGATGAGGCAGCACTGG - Intronic
987787980 5:22526790-22526812 TTCCTAGGTAGAAGCAGTTCTGG + Intronic
991676116 5:69091448-69091470 TTCCTGTGATGAGGCAGTTCTGG - Intergenic
995924921 5:117359797-117359819 TTACTATGATGTGGACGTTCAGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003946719 6:11082849-11082871 TTCCTGTGGTGAGGCCCTTCGGG + Intergenic
1004428526 6:15523049-15523071 GTCCGATGAGGAGGAAGTTCAGG - Exonic
1004852563 6:19715283-19715305 TTCCTTTAATGAGTCAGGTCTGG + Intergenic
1006204856 6:32331651-32331673 TTCCCATGATGAGGGGGTTCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1011220151 6:85046451-85046473 TTTCTTTGATGAGTCAGTTAAGG + Intergenic
1012750052 6:103148996-103149018 TTCATATAATGATGCAGTTATGG + Intergenic
1014048078 6:116917225-116917247 ATCCTGTGATGAGGAAGTACTGG - Intronic
1015940239 6:138442815-138442837 GTCCTATGATGTGGCATTCCAGG - Intronic
1018143066 6:160859053-160859075 TTCTGATGATGAGGCACCTCTGG - Intergenic
1018213173 6:161501922-161501944 TTTCTAAGATGCGGCTGTTCTGG + Intronic
1018712805 6:166508749-166508771 TTCCTCTCTTGAGGCAGTTCTGG + Intronic
1022629213 7:32070024-32070046 GTCCTTTGATGAGTCAGTTATGG - Intronic
1024322171 7:48082237-48082259 TTTTTCTGATGAGGCAGCTCTGG - Intergenic
1024564520 7:50670321-50670343 TTCATAAGATGAGAAAGTTCTGG + Intronic
1024663566 7:51522388-51522410 TTCCTTTCATGAGACAGCTCAGG - Intergenic
1025788044 7:64661476-64661498 TTGCTAGGTTGAGGAAGTTCTGG - Intergenic
1027221616 7:76217741-76217763 TCCCAATAATGAGGCAGTTCTGG + Intronic
1027617506 7:80441967-80441989 TTCTTATGATTAGGCAGTAGGGG - Intronic
1031277777 7:119752480-119752502 TCACTATGATGAGTCATTTCAGG - Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039636955 8:39178066-39178088 TTGCTAGGTTGAGGAAGTTCTGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043312672 8:78880664-78880686 TTCTTATGATCAAGCAGTTTGGG + Intergenic
1043778472 8:84301054-84301076 TACCTCTTATGAGGCAGGTCTGG + Intronic
1044882323 8:96736180-96736202 TTCATATGATTAGGCAGGTCTGG - Intronic
1045428310 8:102088878-102088900 TTCAAATTATGAGACAGTTCTGG + Intronic
1046243337 8:111527077-111527099 TTCCTAAGATGAGGTATCTCTGG + Intergenic
1047597573 8:126394470-126394492 GGCCTAGGATGAGGCTGTTCTGG - Intergenic
1049855481 8:144859056-144859078 TTCTTAGGATGAGGTGGTTCTGG + Intergenic
1050331428 9:4549919-4549941 TTCCTGTGATGTCGCAGCTCTGG + Intronic
1050424526 9:5500086-5500108 GTCCCATGATGAGGCAGTTCTGG + Intergenic
1050424638 9:5500854-5500876 TTCCCGTCATGAGGCAGTTCTGG - Intergenic
1050586715 9:7120231-7120253 TGCCTTTGATGAAGCAGTCCAGG + Intergenic
1051153784 9:14116742-14116764 TTTCTATAATGAGTCAGTTTTGG + Intronic
1052384145 9:27805388-27805410 TGCCCATGATGAGGCAGTTCTGG + Intergenic
1053409889 9:37909134-37909156 GTCTTATGATGAGGGAGCTCAGG - Intronic
1055093364 9:72385466-72385488 TTAGTATGTTGAGGGAGTTCAGG - Intergenic
1055602713 9:77936483-77936505 TTTCTATGATGAAACATTTCAGG - Intronic
1058345051 9:103951058-103951080 TTCCTATGATCAGGCAAGTCTGG + Intergenic
1203457672 Un_GL000220v1:6089-6111 TTGCTATGATGAGGTTTTTCAGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186728837 X:12386112-12386134 TTCCAATTATGAGGCAGATAGGG - Intronic
1192171738 X:68859924-68859946 TTCCTATGATGGGGCGGTAAGGG - Intergenic
1192471251 X:71400562-71400584 ATCCTAAGATGAGGCAGTTGTGG + Intronic
1192873069 X:75203713-75203735 TTCCCATGATGAGGCTGTTCTGG + Intergenic
1192874366 X:75211996-75212018 TTCATAGGATGAGGTGGTTCTGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194069262 X:89299681-89299703 TTCCTATAATGAATCAGTTGTGG - Intergenic
1194141505 X:90215837-90215859 TTCCCATGATGAGGTGGTTCTGG + Intergenic
1194142637 X:90223484-90223506 TCCCCATGATGAGGTGGTTCTGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200487257 Y:3784941-3784963 TTCCCATGATGAGGTGGTTCTGG + Intergenic
1202039115 Y:20664428-20664450 TTCTCATGATGATGCAGTTCTGG - Intergenic
1202039820 Y:20669742-20669764 TTCCCATGGTGAGGTGGTTCTGG - Intergenic