ID: 1109795072

View in Genome Browser
Species Human (GRCh38)
Location 13:67300370-67300392
Sequence CTCTGGTAAAATTGTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109795063_1109795072 29 Left 1109795063 13:67300318-67300340 CCTATCTTTAGGGCCTCCAAATT No data
Right 1109795072 13:67300370-67300392 CTCTGGTAAAATTGTGATGGAGG No data
1109795068_1109795072 3 Left 1109795068 13:67300344-67300366 CCTTTTAGACAGAACAGGGAGCC No data
Right 1109795072 13:67300370-67300392 CTCTGGTAAAATTGTGATGGAGG No data
1109795064_1109795072 16 Left 1109795064 13:67300331-67300353 CCTCCAAATTAAACCTTTTAGAC No data
Right 1109795072 13:67300370-67300392 CTCTGGTAAAATTGTGATGGAGG No data
1109795065_1109795072 13 Left 1109795065 13:67300334-67300356 CCAAATTAAACCTTTTAGACAGA No data
Right 1109795072 13:67300370-67300392 CTCTGGTAAAATTGTGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109795072 Original CRISPR CTCTGGTAAAATTGTGATGG AGG Intergenic
No off target data available for this crispr