ID: 1109797231

View in Genome Browser
Species Human (GRCh38)
Location 13:67331683-67331705
Sequence AAGTGGCTCCAAAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109797231_1109797238 -2 Left 1109797231 13:67331683-67331705 CCCCCTTCCCTTTGGAGCCACTT No data
Right 1109797238 13:67331704-67331726 TTTTTCTAGATTTAAAGCCTTGG No data
1109797231_1109797239 -1 Left 1109797231 13:67331683-67331705 CCCCCTTCCCTTTGGAGCCACTT No data
Right 1109797239 13:67331705-67331727 TTTTCTAGATTTAAAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109797231 Original CRISPR AAGTGGCTCCAAAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr