ID: 1109798161

View in Genome Browser
Species Human (GRCh38)
Location 13:67342999-67343021
Sequence AGCTACAGATCTTCCTACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109798161_1109798167 17 Left 1109798161 13:67342999-67343021 CCATAGTAGGAAGATCTGTAGCT No data
Right 1109798167 13:67343039-67343061 TCCATATAATAACTGTTAGGGGG No data
1109798161_1109798166 16 Left 1109798161 13:67342999-67343021 CCATAGTAGGAAGATCTGTAGCT No data
Right 1109798166 13:67343038-67343060 GTCCATATAATAACTGTTAGGGG No data
1109798161_1109798165 15 Left 1109798161 13:67342999-67343021 CCATAGTAGGAAGATCTGTAGCT No data
Right 1109798165 13:67343037-67343059 AGTCCATATAATAACTGTTAGGG No data
1109798161_1109798164 14 Left 1109798161 13:67342999-67343021 CCATAGTAGGAAGATCTGTAGCT No data
Right 1109798164 13:67343036-67343058 GAGTCCATATAATAACTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109798161 Original CRISPR AGCTACAGATCTTCCTACTA TGG (reversed) Intergenic
No off target data available for this crispr