ID: 1109803003

View in Genome Browser
Species Human (GRCh38)
Location 13:67401929-67401951
Sequence AAGGGCCTGTTAAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109802994_1109803003 9 Left 1109802994 13:67401897-67401919 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG No data
1109802992_1109803003 18 Left 1109802992 13:67401888-67401910 CCTTTCTAACCCTCCAAGTGCAT 0: 7
1: 12
2: 30
3: 23
4: 150
Right 1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG No data
1109802996_1109803003 5 Left 1109802996 13:67401901-67401923 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG No data
1109802995_1109803003 8 Left 1109802995 13:67401898-67401920 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109803003 Original CRISPR AAGGGCCTGTTAAACTCTGG GGG Intergenic
No off target data available for this crispr