ID: 1109811495

View in Genome Browser
Species Human (GRCh38)
Location 13:67519043-67519065
Sequence TCTATTAGCTTCCATGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109811492_1109811495 10 Left 1109811492 13:67519010-67519032 CCCTCCTGGGGAGAACGGTAGGA No data
Right 1109811495 13:67519043-67519065 TCTATTAGCTTCCATGAAGCTGG No data
1109811490_1109811495 11 Left 1109811490 13:67519009-67519031 CCCCTCCTGGGGAGAACGGTAGG No data
Right 1109811495 13:67519043-67519065 TCTATTAGCTTCCATGAAGCTGG No data
1109811494_1109811495 6 Left 1109811494 13:67519014-67519036 CCTGGGGAGAACGGTAGGAGAGT No data
Right 1109811495 13:67519043-67519065 TCTATTAGCTTCCATGAAGCTGG No data
1109811493_1109811495 9 Left 1109811493 13:67519011-67519033 CCTCCTGGGGAGAACGGTAGGAG No data
Right 1109811495 13:67519043-67519065 TCTATTAGCTTCCATGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109811495 Original CRISPR TCTATTAGCTTCCATGAAGC TGG Intergenic
No off target data available for this crispr