ID: 1109813532

View in Genome Browser
Species Human (GRCh38)
Location 13:67547508-67547530
Sequence ATAGGAAAAGGGCCCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109813532_1109813535 -10 Left 1109813532 13:67547508-67547530 CCACAGCAGGGCCCTTTTCCTAT No data
Right 1109813535 13:67547521-67547543 CTTTTCCTATCAGAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109813532 Original CRISPR ATAGGAAAAGGGCCCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr