ID: 1109814962

View in Genome Browser
Species Human (GRCh38)
Location 13:67569414-67569436
Sequence GGACCATGTGGACCACAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109814956_1109814962 13 Left 1109814956 13:67569378-67569400 CCAGAATGATGTTCTGTGTGATG No data
Right 1109814962 13:67569414-67569436 GGACCATGTGGACCACAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109814962 Original CRISPR GGACCATGTGGACCACAAGG AGG Intergenic
No off target data available for this crispr