ID: 1109818915

View in Genome Browser
Species Human (GRCh38)
Location 13:67625516-67625538
Sequence TACTCATCACTTATTGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109818913_1109818915 3 Left 1109818913 13:67625490-67625512 CCTGGGGTACATGAAGACATCAC No data
Right 1109818915 13:67625516-67625538 TACTCATCACTTATTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109818915 Original CRISPR TACTCATCACTTATTGAATA AGG Intergenic
No off target data available for this crispr