ID: 1109821916

View in Genome Browser
Species Human (GRCh38)
Location 13:67668288-67668310
Sequence TGTCAAATAGGTGAAGGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109821916_1109821921 0 Left 1109821916 13:67668288-67668310 CCTTATCCTTCACCTATTTGACA No data
Right 1109821921 13:67668311-67668333 TATACCTACCCTCCCTGGGTTGG No data
1109821916_1109821920 -4 Left 1109821916 13:67668288-67668310 CCTTATCCTTCACCTATTTGACA No data
Right 1109821920 13:67668307-67668329 GACATATACCTACCCTCCCTGGG No data
1109821916_1109821919 -5 Left 1109821916 13:67668288-67668310 CCTTATCCTTCACCTATTTGACA No data
Right 1109821919 13:67668306-67668328 TGACATATACCTACCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109821916 Original CRISPR TGTCAAATAGGTGAAGGATA AGG (reversed) Intergenic
No off target data available for this crispr