ID: 1109824414

View in Genome Browser
Species Human (GRCh38)
Location 13:67698738-67698760
Sequence TCTCATAAACTTAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109824411_1109824414 -7 Left 1109824411 13:67698722-67698744 CCTAAAACATAAGGACTCTCATA No data
Right 1109824414 13:67698738-67698760 TCTCATAAACTTAAGGTAAAGGG No data
1109824409_1109824414 26 Left 1109824409 13:67698689-67698711 CCAAGCAAGTATCTGCTGTCTTC No data
Right 1109824414 13:67698738-67698760 TCTCATAAACTTAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109824414 Original CRISPR TCTCATAAACTTAAGGTAAA GGG Intergenic
No off target data available for this crispr