ID: 1109825277

View in Genome Browser
Species Human (GRCh38)
Location 13:67710975-67710997
Sequence TTGAAAAAGCCTGTGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109825274_1109825277 17 Left 1109825274 13:67710935-67710957 CCTTAACAAAATGAAAGTGTTAC No data
Right 1109825277 13:67710975-67710997 TTGAAAAAGCCTGTGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109825277 Original CRISPR TTGAAAAAGCCTGTGGAGCA AGG Intergenic
No off target data available for this crispr