ID: 1109828773

View in Genome Browser
Species Human (GRCh38)
Location 13:67757685-67757707
Sequence GGAAAAATAATGGACCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109828770_1109828773 -10 Left 1109828770 13:67757672-67757694 CCCATTCTCTCTGGGAAAAATAA No data
Right 1109828773 13:67757685-67757707 GGAAAAATAATGGACCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109828773 Original CRISPR GGAAAAATAATGGACCTACA TGG Intergenic
No off target data available for this crispr