ID: 1109841946

View in Genome Browser
Species Human (GRCh38)
Location 13:67929533-67929555
Sequence TGAAAGCTATATATCTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109841946_1109841949 -8 Left 1109841946 13:67929533-67929555 CCCCTGAAGATATATAGCTTTCA No data
Right 1109841949 13:67929548-67929570 AGCTTTCACAGTTCCTAACTTGG No data
1109841946_1109841951 25 Left 1109841946 13:67929533-67929555 CCCCTGAAGATATATAGCTTTCA No data
Right 1109841951 13:67929581-67929603 CATTTCTTTTCAACAAGAAAAGG No data
1109841946_1109841952 26 Left 1109841946 13:67929533-67929555 CCCCTGAAGATATATAGCTTTCA No data
Right 1109841952 13:67929582-67929604 ATTTCTTTTCAACAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109841946 Original CRISPR TGAAAGCTATATATCTTCAG GGG (reversed) Intergenic
No off target data available for this crispr