ID: 1109842062

View in Genome Browser
Species Human (GRCh38)
Location 13:67931608-67931630
Sequence AAAATAATGCCGTAAGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109842062_1109842063 -10 Left 1109842062 13:67931608-67931630 CCATTTACTTACGGCATTATTTT No data
Right 1109842063 13:67931621-67931643 GCATTATTTTTTTTTTCCCTTGG No data
1109842062_1109842067 28 Left 1109842062 13:67931608-67931630 CCATTTACTTACGGCATTATTTT No data
Right 1109842067 13:67931659-67931681 TTCTGTTTTGAGTTTATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109842062 Original CRISPR AAAATAATGCCGTAAGTAAA TGG (reversed) Intergenic
No off target data available for this crispr