ID: 1109843348

View in Genome Browser
Species Human (GRCh38)
Location 13:67949959-67949981
Sequence CTCTAGAAGTAGTAGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109843348_1109843349 25 Left 1109843348 13:67949959-67949981 CCATCATACTACTACTTCTAGAG No data
Right 1109843349 13:67950007-67950029 ATAAATTCATATCCAGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109843348 Original CRISPR CTCTAGAAGTAGTAGTATGA TGG (reversed) Intergenic
No off target data available for this crispr