ID: 1109853133

View in Genome Browser
Species Human (GRCh38)
Location 13:68093837-68093859
Sequence GCACCCATCATGATTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109853131_1109853133 9 Left 1109853131 13:68093805-68093827 CCGGGCCTGCTATGGCAATGTTC No data
Right 1109853133 13:68093837-68093859 GCACCCATCATGATTAAAGATGG No data
1109853132_1109853133 4 Left 1109853132 13:68093810-68093832 CCTGCTATGGCAATGTTCAGTCT No data
Right 1109853133 13:68093837-68093859 GCACCCATCATGATTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109853133 Original CRISPR GCACCCATCATGATTAAAGA TGG Intergenic
No off target data available for this crispr