ID: 1109853437

View in Genome Browser
Species Human (GRCh38)
Location 13:68099259-68099281
Sequence GGAACATTTGTGTTTAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109853437_1109853440 13 Left 1109853437 13:68099259-68099281 CCCTCTTTAAACACAAATGTTCC No data
Right 1109853440 13:68099295-68099317 AATGATGAATCCTTTTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109853437 Original CRISPR GGAACATTTGTGTTTAAAGA GGG (reversed) Intergenic
No off target data available for this crispr