ID: 1109853481

View in Genome Browser
Species Human (GRCh38)
Location 13:68099738-68099760
Sequence GGTTTTATGGGGATTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109853475_1109853481 -3 Left 1109853475 13:68099718-68099740 CCTGAGGAGTTCTGGACTGGGGT No data
Right 1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG No data
1109853469_1109853481 10 Left 1109853469 13:68099705-68099727 CCAAATTCATCTCCCTGAGGAGT No data
Right 1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG No data
1109853467_1109853481 13 Left 1109853467 13:68099702-68099724 CCACCAAATTCATCTCCCTGAGG No data
Right 1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG No data
1109853473_1109853481 -2 Left 1109853473 13:68099717-68099739 CCCTGAGGAGTTCTGGACTGGGG No data
Right 1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109853481 Original CRISPR GGTTTTATGGGGATTGTGGT GGG Intergenic
No off target data available for this crispr