ID: 1109857390

View in Genome Browser
Species Human (GRCh38)
Location 13:68149458-68149480
Sequence GTGAGCAATATGAGTACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109857387_1109857390 1 Left 1109857387 13:68149434-68149456 CCGTACTCAATGTTCTACCTCTT No data
Right 1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG No data
1109857386_1109857390 16 Left 1109857386 13:68149419-68149441 CCTTCACAGATGTTTCCGTACTC No data
Right 1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG No data
1109857383_1109857390 27 Left 1109857383 13:68149408-68149430 CCAGAGTCCCACCTTCACAGATG No data
Right 1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG No data
1109857382_1109857390 28 Left 1109857382 13:68149407-68149429 CCCAGAGTCCCACCTTCACAGAT No data
Right 1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG No data
1109857384_1109857390 20 Left 1109857384 13:68149415-68149437 CCCACCTTCACAGATGTTTCCGT No data
Right 1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG No data
1109857385_1109857390 19 Left 1109857385 13:68149416-68149438 CCACCTTCACAGATGTTTCCGTA No data
Right 1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109857390 Original CRISPR GTGAGCAATATGAGTACTGC TGG Intergenic
No off target data available for this crispr