ID: 1109858280

View in Genome Browser
Species Human (GRCh38)
Location 13:68162555-68162577
Sequence CTTCTATACTTGGGCAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109858280_1109858286 21 Left 1109858280 13:68162555-68162577 CCCATTTTGCCCAAGTATAGAAG No data
Right 1109858286 13:68162599-68162621 GTGTGAGAACATCTAACTACTGG No data
1109858280_1109858284 -1 Left 1109858280 13:68162555-68162577 CCCATTTTGCCCAAGTATAGAAG No data
Right 1109858284 13:68162577-68162599 GCTGAGTGTTTCCTTCTCTTTGG No data
1109858280_1109858288 23 Left 1109858280 13:68162555-68162577 CCCATTTTGCCCAAGTATAGAAG No data
Right 1109858288 13:68162601-68162623 GTGAGAACATCTAACTACTGGGG No data
1109858280_1109858289 24 Left 1109858280 13:68162555-68162577 CCCATTTTGCCCAAGTATAGAAG No data
Right 1109858289 13:68162602-68162624 TGAGAACATCTAACTACTGGGGG No data
1109858280_1109858290 28 Left 1109858280 13:68162555-68162577 CCCATTTTGCCCAAGTATAGAAG No data
Right 1109858290 13:68162606-68162628 AACATCTAACTACTGGGGGAAGG No data
1109858280_1109858287 22 Left 1109858280 13:68162555-68162577 CCCATTTTGCCCAAGTATAGAAG No data
Right 1109858287 13:68162600-68162622 TGTGAGAACATCTAACTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109858280 Original CRISPR CTTCTATACTTGGGCAAAAT GGG (reversed) Intergenic
No off target data available for this crispr