ID: 1109861276

View in Genome Browser
Species Human (GRCh38)
Location 13:68201837-68201859
Sequence TGTTCTCTGTTTACAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109861275_1109861276 15 Left 1109861275 13:68201799-68201821 CCAAGATTAGTGCACTGGCATTG No data
Right 1109861276 13:68201837-68201859 TGTTCTCTGTTTACAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109861276 Original CRISPR TGTTCTCTGTTTACAAAATG AGG Intergenic
No off target data available for this crispr